EMAIL THIS PAGE TO A FRIEND

HDLBP

high density lipoprotein binding protein

74 Gene Product Result for
Synonyms: HBP PRO2900 VGL
UniProtKB ID: Q00341, B4DTQ2, E7EM71, Q53QU2, Q9UCY3
Gene ID:
Human(3069) Summary: The protein encoded by this gene binds high density lipoprotein (HDL) and may function to regulate excess cholesterol levels in cells. The encoded protein also binds RNA and can induce heterochromatin formation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(110611) high density lipoprotein (HDL) binding protein
Rat(64474) high density lipoprotein binding protein
sheep(101101945) high density lipoprotein binding protein
domestic guinea pig(100724773) high density lipoprotein binding protein
naked mole-rat(101714731) high density lipoprotein binding protein
Zebrafish(794178) high density lipoprotein-binding protein (vigilin)
dog(477431) high density lipoprotein binding protein
chicken(395984) high density lipoprotein binding protein
domestic cat(101090637) high density lipoprotein binding protein
cow(767882) high density lipoprotein binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108531 Anti-HDLBP affinity isolated antibody bovine, mouse, horse, mouse, rat, canine, rabbit, guinea pig, human
western blot pricing
HPA004189 Anti-HDLBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV40581 Anti-HDLBP antibody produced in rabbit affinity isolated antibody bovine, rabbit, horse, human, rat, mouse, canine, pig, guinea pig
western blot pricing
SAB2104974 Anti-HDLBP antibody produced in rabbit affinity isolated antibody human, rat, horse, guinea pig, rabbit, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005336 Rosetta Predictions human pricing
NM_203346 Rosetta Predictions human pricing
NM_172039 Rosetta Predictions rat pricing
NM_133808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146186 predicted 1971
2 SASI_Hs01_00146187 predicted 1891
3 SASI_Hs02_00339405 predicted 3071
4 SASI_Hs01_00146188 predicted 1452
5 SASI_Hs01_00146189 predicted 3222
6 SASI_Hs01_00146190 predicted 1679
7 SASI_Hs01_00146192 predicted 1898
8 SASI_Hs01_00146193 predicted 2992
9 SASI_Hs01_00146194 predicted 700
10 SASI_Hs02_00339406 predicted 2320
11 SASI_Hs01_00146191 predicted 3813
12 SASI_Hs01_00146195 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160493 predicted 1825
2 SASI_Hs01_00160494 predicted 1745
3 SASI_Hs02_00373281 predicted 2929
4 SASI_Hs01_00160495 predicted 1305
5 SASI_Hs01_00160496 predicted 3071
6 SASI_Hs01_00160497 predicted 1539
7 SASI_Hs01_00160499 predicted 1756
8 SASI_Hs01_00160500 predicted 2840
9 SASI_Hs01_00160501 predicted 564
10 SASI_Hs02_00373282 predicted 2176
11 SASI_Hs01_00160498 predicted 3642
12 SASI_Hs01_00160502 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106071 predicted 1359
2 SASI_Rn02_00269130 predicted 1492
3 SASI_Rn01_00106072 predicted 3305
4 SASI_Rn01_00106073 predicted 2749
5 SASI_Rn02_00269131 predicted 683
6 SASI_Rn02_00269132 predicted 2259
7 SASI_Rn01_00106074 predicted 2216
8 SASI_Rn01_00106075 predicted 4063
9 SASI_Rn01_00106076 predicted 1696
10 SASI_Rn01_00106077 predicted 2871
11 SASI_Rn01_00106070 predicted 2635
12 SASI_Rn01_00106078 predicted 2386
13 SASI_Rn01_00106079 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173513 predicted 2511
2 SASI_Mm01_00173514 predicted 1510
3 SASI_Mm01_00173515 predicted 3324
4 SASI_Mm01_00173516 predicted 2168
5 SASI_Mm02_00338836 predicted 3667
6 SASI_Mm02_00338837 predicted 3176
7 SASI_Mm01_00173517 predicted 1944
8 SASI_Mm01_00173518 predicted 2241
9 SASI_Mm01_00173519 predicted 1103
10 SASI_Mm02_00338838 predicted 1886
11 SASI_Mm01_00173520 predicted 1083
12 SASI_Mm01_00173521 predicted 1219
13 SASI_Mm01_00173522 predicted 2421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005336
VALIDATED
HDLBP MISSION shRNA Bacterial Glycerol Stock
high density lipoprotein binding protein
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-1714s1c1
Sequence:CCGGGCGGTGCCAACATAAACAGAACTCGAGTTCTGTTTATGTTGGCACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-3041s1c1
Sequence:CCGGCCAGCAGATTACTCGGGATTTCTCGAGAAATCCCGAGTAATCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-1715s1c1
Sequence:CCGGCGGTGCCAACATAAACAGAATCTCGAGATTCTGTTTATGTTGGCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005336.2-4359s1c1
Sequence:CCGGGCTCCACTGTTTAACACTAAACTCGAGTTTAGTGTTAAACAGTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005336.2-1197s1c1
Sequence:CCGGGCTCGCATCAAGAAGATTTATCTCGAGATAAATCTTCTTGATGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005336.2-4251s1c1
Sequence:CCGGCCGTAAATTGTTGACGCTCTTCTCGAGAAGAGCGTCAACAATTTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005336.2-3306s1c1
Sequence:CCGGCGTTACGTTATTGGGCAGAAACTCGAGTTTCTGCCCAATAACGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005336.2-836s1c1
Sequence:CCGGCCATCGCTTTGTTATTGGCAACTCGAGTTGCCAATAACAAAGCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005336.2-3305s1c1
Sequence:CCGGCCGTTACGTTATTGGGCAGAACTCGAGTTCTGCCCAATAACGTAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005336.2-3596s1c1
Sequence:CCGGGCATGACGTGAACATCCAGTTCTCGAGAACTGGATGTTCACGTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-2553s1c1
Sequence:CCGGGCCAAGCCAGAATACCACAAACTCGAGTTTGTGGTATTCTGGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-1733s21c1
Sequence:CCGGGCGGTGCCAACATAAACAGAACTCGAGTTCTGTTTATGTTGGCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-3324s21c1
Sequence:CCGGCCGTTACGTTATTGGGCAGAACTCGAGTTCTGCCCAATAACGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-2572s21c1
Sequence:CCGGGCCAAGCCAGAATACCACAAACTCGAGTTTGTGGTATTCTGGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-3060s21c1
Sequence:CCGGCCAGCAGATTACTCGGGATTTCTCGAGAAATCCCGAGTAATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005336
VALIDATED
HDLBP MISSION shRNA shRNA Plasmid DNA
high density lipoprotein binding protein
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-1714s1c1
Sequence:CCGGGCGGTGCCAACATAAACAGAACTCGAGTTCTGTTTATGTTGGCACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-3041s1c1
Sequence:CCGGCCAGCAGATTACTCGGGATTTCTCGAGAAATCCCGAGTAATCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-1715s1c1
Sequence:CCGGCGGTGCCAACATAAACAGAATCTCGAGATTCTGTTTATGTTGGCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005336.2-4359s1c1
Sequence:CCGGGCTCCACTGTTTAACACTAAACTCGAGTTTAGTGTTAAACAGTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005336.2-1197s1c1
Sequence:CCGGGCTCGCATCAAGAAGATTTATCTCGAGATAAATCTTCTTGATGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005336.2-4251s1c1
Sequence:CCGGCCGTAAATTGTTGACGCTCTTCTCGAGAAGAGCGTCAACAATTTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005336.2-3306s1c1
Sequence:CCGGCGTTACGTTATTGGGCAGAAACTCGAGTTTCTGCCCAATAACGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005336.2-836s1c1
Sequence:CCGGCCATCGCTTTGTTATTGGCAACTCGAGTTGCCAATAACAAAGCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005336.2-3305s1c1
Sequence:CCGGCCGTTACGTTATTGGGCAGAACTCGAGTTCTGCCCAATAACGTAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005336.2-3596s1c1
Sequence:CCGGGCATGACGTGAACATCCAGTTCTCGAGAACTGGATGTTCACGTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-2553s1c1
Sequence:CCGGGCCAAGCCAGAATACCACAAACTCGAGTTTGTGGTATTCTGGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-1733s21c1
Sequence:CCGGGCGGTGCCAACATAAACAGAACTCGAGTTCTGTTTATGTTGGCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-3324s21c1
Sequence:CCGGCCGTTACGTTATTGGGCAGAACTCGAGTTCTGCCCAATAACGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-2572s21c1
Sequence:CCGGGCCAAGCCAGAATACCACAAACTCGAGTTTGTGGTATTCTGGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-3060s21c1
Sequence:CCGGCCAGCAGATTACTCGGGATTTCTCGAGAAATCCCGAGTAATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005336
VALIDATED
HDLBP MISSION shRNA Lentiviral Transduction Particles
high density lipoprotein binding protein
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-1714s1c1
Sequence:CCGGGCGGTGCCAACATAAACAGAACTCGAGTTCTGTTTATGTTGGCACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-3041s1c1
Sequence:CCGGCCAGCAGATTACTCGGGATTTCTCGAGAAATCCCGAGTAATCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-1715s1c1
Sequence:CCGGCGGTGCCAACATAAACAGAATCTCGAGATTCTGTTTATGTTGGCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005336.2-4359s1c1
Sequence:CCGGGCTCCACTGTTTAACACTAAACTCGAGTTTAGTGTTAAACAGTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005336.2-1197s1c1
Sequence:CCGGGCTCGCATCAAGAAGATTTATCTCGAGATAAATCTTCTTGATGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005336.2-4251s1c1
Sequence:CCGGCCGTAAATTGTTGACGCTCTTCTCGAGAAGAGCGTCAACAATTTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005336.2-3306s1c1
Sequence:CCGGCGTTACGTTATTGGGCAGAAACTCGAGTTTCTGCCCAATAACGTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005336.2-836s1c1
Sequence:CCGGCCATCGCTTTGTTATTGGCAACTCGAGTTGCCAATAACAAAGCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005336.2-3305s1c1
Sequence:CCGGCCGTTACGTTATTGGGCAGAACTCGAGTTCTGCCCAATAACGTAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005336.2-3596s1c1
Sequence:CCGGGCATGACGTGAACATCCAGTTCTCGAGAACTGGATGTTCACGTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005336.2-2553s1c1
Sequence:CCGGGCCAAGCCAGAATACCACAAACTCGAGTTTGTGGTATTCTGGCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-1733s21c1
Sequence:CCGGGCGGTGCCAACATAAACAGAACTCGAGTTCTGTTTATGTTGGCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-3324s21c1
Sequence:CCGGCCGTTACGTTATTGGGCAGAACTCGAGTTCTGCCCAATAACGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-2572s21c1
Sequence:CCGGGCCAAGCCAGAATACCACAAACTCGAGTTTGTGGTATTCTGGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005336.3-3060s21c1
Sequence:CCGGCCAGCAGATTACTCGGGATTTCTCGAGAAATCCCGAGTAATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133808
VALIDATED
HDLBP MISSION shRNA Bacterial Glycerol Stock
high density lipoprotein binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133808.2-5537s1c1
Sequence:CCGGCCCATTTAATAACTCAGGCTTCTCGAGAAGCCTGAGTTATTAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133808.2-285s1c1
Sequence:CCGGCCTTAAATTCAGAAGAGGAAACTCGAGTTTCCTCTTCTGAATTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1564s1c1
Sequence:CCGGCGGAGCCAACATCAACAGAATCTCGAGATTCTGTTGATGTTGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1814s1c1
Sequence:CCGGCCAGAGGTTATCATCAACTTTCTCGAGAAAGTTGATGATAACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1046s1c1
Sequence:CCGGGCTCGCATTAAGAAGATTTATCTCGAGATAAATCTTCTTAATGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1810s21c1
Sequence:CCGGCCAGAGGTTATCATCAACTTTCTCGAGAAAGTTGATGATAACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1042s21c1
Sequence:CCGGGCTCGCATTAAGAAGATTTATCTCGAGATAAATCTTCTTAATGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1477s21c1
Sequence:CCGGATGGTCAAAGACCTGATTAATCTCGAGATTAATCAGGTCTTTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133808.4-4077s21c1
Sequence:CCGGGCAGCTGGACCCTCGTAAATTCTCGAGAATTTACGAGGGTCCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1560s21c1
Sequence:CCGGCGGAGCCAACATCAACAGAATCTCGAGATTCTGTTGATGTTGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133808
VALIDATED
HDLBP MISSION shRNA shRNA Plasmid DNA
high density lipoprotein binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133808.2-5537s1c1
Sequence:CCGGCCCATTTAATAACTCAGGCTTCTCGAGAAGCCTGAGTTATTAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133808.2-285s1c1
Sequence:CCGGCCTTAAATTCAGAAGAGGAAACTCGAGTTTCCTCTTCTGAATTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1564s1c1
Sequence:CCGGCGGAGCCAACATCAACAGAATCTCGAGATTCTGTTGATGTTGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1814s1c1
Sequence:CCGGCCAGAGGTTATCATCAACTTTCTCGAGAAAGTTGATGATAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1046s1c1
Sequence:CCGGGCTCGCATTAAGAAGATTTATCTCGAGATAAATCTTCTTAATGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1810s21c1
Sequence:CCGGCCAGAGGTTATCATCAACTTTCTCGAGAAAGTTGATGATAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1042s21c1
Sequence:CCGGGCTCGCATTAAGAAGATTTATCTCGAGATAAATCTTCTTAATGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1477s21c1
Sequence:CCGGATGGTCAAAGACCTGATTAATCTCGAGATTAATCAGGTCTTTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133808.4-4077s21c1
Sequence:CCGGGCAGCTGGACCCTCGTAAATTCTCGAGAATTTACGAGGGTCCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1560s21c1
Sequence:CCGGCGGAGCCAACATCAACAGAATCTCGAGATTCTGTTGATGTTGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133808
VALIDATED
HDLBP MISSION shRNA Lentiviral Transduction Particles
high density lipoprotein binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133808.2-5537s1c1
Sequence:CCGGCCCATTTAATAACTCAGGCTTCTCGAGAAGCCTGAGTTATTAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133808.2-285s1c1
Sequence:CCGGCCTTAAATTCAGAAGAGGAAACTCGAGTTTCCTCTTCTGAATTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1564s1c1
Sequence:CCGGCGGAGCCAACATCAACAGAATCTCGAGATTCTGTTGATGTTGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1814s1c1
Sequence:CCGGCCAGAGGTTATCATCAACTTTCTCGAGAAAGTTGATGATAACCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133808.2-1046s1c1
Sequence:CCGGGCTCGCATTAAGAAGATTTATCTCGAGATAAATCTTCTTAATGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1810s21c1
Sequence:CCGGCCAGAGGTTATCATCAACTTTCTCGAGAAAGTTGATGATAACCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1042s21c1
Sequence:CCGGGCTCGCATTAAGAAGATTTATCTCGAGATAAATCTTCTTAATGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1477s21c1
Sequence:CCGGATGGTCAAAGACCTGATTAATCTCGAGATTAATCAGGTCTTTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133808.4-4077s21c1
Sequence:CCGGGCAGCTGGACCCTCGTAAATTCTCGAGAATTTACGAGGGTCCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133808.4-1560s21c1
Sequence:CCGGCGGAGCCAACATCAACAGAATCTCGAGATTCTGTTGATGTTGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)