EMAIL THIS PAGE TO A FRIEND

HDX

highly divergent homeobox

98 Gene Product Result for
Synonyms: CXorf43 D030011N01Rik
UniProtKB ID: Q7Z353, A8K1Y5, B7ZL18, Q5JZB4, Q96NK7
Gene ID:
Mouse(245596) highly divergent homeobox
chicken(422272) highly divergent homeobox
domestic cat(101094656) highly divergent homeobox
cow(523251) highly divergent homeobox
Horse(100071712) highly divergent homeobox
dog(491990) highly divergent homeobox
sheep(101122331) highly divergent homeobox
Domestic Rabbit(100347272) highly divergent homeobox
domestic guinea pig(100721157) highly divergent homeobox
naked mole-rat(101702647) highly divergent homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144657 Rosetta Predictions human pricing
NM_001080549 Rosetta Predictions mouse pricing
XM_142098 Rosetta Predictions mouse pricing
XM_973136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364537 predicted 2163
2 SASI_Hs01_00041667 predicted 446
3 SASI_Hs01_00041670 predicted 1260
4 SASI_Hs01_00041671 predicted 1450
5 SASI_Hs01_00041672 predicted 1790
6 SASI_Hs01_00041674 predicted 1759
7 SASI_Hs01_00041675 predicted 2124
8 SASI_Hs02_00364538 predicted 1341
9 SASI_Hs01_00041676 predicted 1571
10 SASI_Hs02_00364539 predicted 1717
11 SASI_Hs01_00041668 predicted 1329
12 SASI_Hs01_00041669 predicted 413
13 SASI_Hs01_00041673 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293473 predicted 480
2 SASI_Mm02_00293474 predicted 413
3 SASI_Mm02_00293475 predicted 1738
4 SASI_Mm02_00293476 predicted 468
5 SASI_Mm02_00293477 predicted 2211
6 SASI_Mm02_00293478 predicted 1938
7 SASI_Mm02_00293479 predicted 1782
8 SASI_Mm02_00293480 predicted 669
9 SASI_Mm02_00293481 predicted 1353
10 SASI_Mm02_00293482 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_142098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284109 predicted 365
2 SASI_Mm01_00284110 predicted 310
3 SASI_Mm01_00284111 predicted 354
4 SASI_Mm01_00284112 predicted 683
5 SASI_Mm01_00284113 predicted 1157
6 SASI_Mm01_00284114 predicted 1088
7 SASI_Mm01_00284115 predicted 250
8 SASI_Mm01_00284116 predicted 560
9 SASI_Mm01_00284117 predicted 570
10 SASI_Mm01_00284118 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213913 predicted 1750
2 SASI_Mm01_00213914 predicted 1598
3 SASI_Mm01_00213915 predicted 2068
4 SASI_Mm01_00213916 predicted 1649
5 SASI_Mm01_00213917 predicted 1886
6 SASI_Mm01_00213918 predicted 1125
7 SASI_Mm01_00213919 predicted 1051
8 SASI_Mm01_00213920 predicted 2096
9 SASI_Mm01_00213921 predicted 2142
10 SASI_Mm01_00213922 predicted 1216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144657
HDX MISSION shRNA Bacterial Glycerol Stock
highly divergent homeobox
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144657.3-908s21c1
Sequence:CCAGTCATTGGCAGTTAGCGATTACCTCGAGGTAATCGCTAACTGCCAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144657.3-1578s21c1
Sequence:CCGGGAAGAAGGAAATATCGTTTAACTCGAGTTAAACGATATTTCCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-820s1c1
Sequence:CCGGGCCCAGCATTACATAACTTATCTCGAGATAAGTTATGTAATGCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-970s1c1
Sequence:CCGGGCTCAGCAGAAGGAAATTGTTCTCGAGAACAATTTCCTTCTGCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-411s1c1
Sequence:CCGGGCCAATAATGATGTCATTGTACTCGAGTACAATGACATCATTATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-1279s1c1
Sequence:CCGGCCAATCCATTACGGAGTAATTCTCGAGAATTACTCCGTAATGGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-1792s1c1
Sequence:CCGGCGAATGATGCAAGGGCTCATACTCGAGTATGAGCCCTTGCATCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144657
HDX MISSION shRNA shRNA Plasmid DNA
highly divergent homeobox
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144657.3-908s21c1
Sequence:CCAGTCATTGGCAGTTAGCGATTACCTCGAGGTAATCGCTAACTGCCAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144657.3-1578s21c1
Sequence:CCGGGAAGAAGGAAATATCGTTTAACTCGAGTTAAACGATATTTCCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-820s1c1
Sequence:CCGGGCCCAGCATTACATAACTTATCTCGAGATAAGTTATGTAATGCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-970s1c1
Sequence:CCGGGCTCAGCAGAAGGAAATTGTTCTCGAGAACAATTTCCTTCTGCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-411s1c1
Sequence:CCGGGCCAATAATGATGTCATTGTACTCGAGTACAATGACATCATTATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-1279s1c1
Sequence:CCGGCCAATCCATTACGGAGTAATTCTCGAGAATTACTCCGTAATGGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-1792s1c1
Sequence:CCGGCGAATGATGCAAGGGCTCATACTCGAGTATGAGCCCTTGCATCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144657
HDX MISSION shRNA Lentiviral Transduction Particles
highly divergent homeobox
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144657.3-908s21c1
Sequence:CCAGTCATTGGCAGTTAGCGATTACCTCGAGGTAATCGCTAACTGCCAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144657.3-1578s21c1
Sequence:CCGGGAAGAAGGAAATATCGTTTAACTCGAGTTAAACGATATTTCCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-820s1c1
Sequence:CCGGGCCCAGCATTACATAACTTATCTCGAGATAAGTTATGTAATGCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-970s1c1
Sequence:CCGGGCTCAGCAGAAGGAAATTGTTCTCGAGAACAATTTCCTTCTGCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-411s1c1
Sequence:CCGGGCCAATAATGATGTCATTGTACTCGAGTACAATGACATCATTATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-1279s1c1
Sequence:CCGGCCAATCCATTACGGAGTAATTCTCGAGAATTACTCCGTAATGGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144657.2-1792s1c1
Sequence:CCGGCGAATGATGCAAGGGCTCATACTCGAGTATGAGCCCTTGCATCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080549
HDX MISSION shRNA Bacterial Glycerol Stock
highly divergent homeobox
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-1060s21c1
Sequence:GTACCGGCATCAATGGGAGCACAAATAACTCGAGTTATTTGTGCTCCCATTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-1289s21c1
Sequence:CCGGTAATCCATCACGGAGTAATTTCTCGAGAAATTACTCCGTGATGGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-794s21c1
Sequence:CCGGTGGGATTCAAAGGTCATATAACTCGAGTTATATGACCTTTGAATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-431s21c1
Sequence:CCGGTGTCATTGTAACTGGTATATACTCGAGTATATACCAGTTACAATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080549.2-3411s21c1
Sequence:CCGGTAGGTTGTGTGGAACTATATTCTCGAGAATATAGTTCCACACAACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080549
HDX MISSION shRNA shRNA Plasmid DNA
highly divergent homeobox
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-1060s21c1
Sequence:GTACCGGCATCAATGGGAGCACAAATAACTCGAGTTATTTGTGCTCCCATTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-1289s21c1
Sequence:CCGGTAATCCATCACGGAGTAATTTCTCGAGAAATTACTCCGTGATGGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-794s21c1
Sequence:CCGGTGGGATTCAAAGGTCATATAACTCGAGTTATATGACCTTTGAATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-431s21c1
Sequence:CCGGTGTCATTGTAACTGGTATATACTCGAGTATATACCAGTTACAATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080549.2-3411s21c1
Sequence:CCGGTAGGTTGTGTGGAACTATATTCTCGAGAATATAGTTCCACACAACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080549
HDX MISSION shRNA Lentiviral Transduction Particles
highly divergent homeobox
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-1060s21c1
Sequence:GTACCGGCATCAATGGGAGCACAAATAACTCGAGTTATTTGTGCTCCCATTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-1289s21c1
Sequence:CCGGTAATCCATCACGGAGTAATTTCTCGAGAAATTACTCCGTGATGGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-794s21c1
Sequence:CCGGTGGGATTCAAAGGTCATATAACTCGAGTTATATGACCTTTGAATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080549.2-431s21c1
Sequence:CCGGTGTCATTGTAACTGGTATATACTCGAGTATATACCAGTTACAATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080549.2-3411s21c1
Sequence:CCGGTAGGTTGTGTGGAACTATATTCTCGAGAATATAGTTCCACACAACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)