EMAIL THIS PAGE TO A FRIEND

HEATR2

HEAT repeat containing 2

83 Gene Product Result for
Synonyms: CILD18
UniProtKB ID: Q86Y56, Q69YL1, Q96FI9, Q9NX75
Gene ID:
Human(54919) Summary: The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(433956) HEAT repeat containing 2
Rat(304332) HEAT repeat containing 2
domestic guinea pig(100713562) HEAT repeat containing 2
naked mole-rat(101700354) HEAT repeat containing 2
sheep(101115933) HEAT repeat containing 2
chicken(416447) HEAT repeat containing 2
domestic cat(101087542) HEAT repeat containing 2
dog(491598) HEAT repeat containing 2
cow(100300875) HEAT repeat containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017802 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074351 MISSION® esiRNA esiRNA human HEATR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017802 Rosetta Predictions human pricing
NM_001134857 Rosetta Predictions rat pricing
XM_001065453 Rosetta Predictions rat pricing
NM_001081265 Rosetta Predictions mouse pricing
XM_620267 Rosetta Predictions mouse pricing
XM_987724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131575 predicted 2478
2 SASI_Hs02_00350666 predicted 1334
3 SASI_Hs01_00131576 predicted 2172
4 SASI_Hs01_00131577 predicted 2246
5 SASI_Hs01_00131578 predicted 2393
6 SASI_Hs01_00131579 predicted 2231
7 SASI_Hs01_00131580 predicted 2185
8 SASI_Hs01_00131581 predicted 854
9 SASI_Hs01_00131583 predicted 2691
10 SASI_Hs01_00131584 predicted 2759
11 SASI_Hs01_00131582 predicted 2639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258774 predicted 851
2 SASI_Rn02_00258775 predicted 815
3 SASI_Rn02_00258776 predicted 2193
4 SASI_Rn02_00258777 predicted 1924
5 SASI_Rn02_00258778 predicted 2026
6 SASI_Rn02_00258779 predicted 2448
7 SASI_Rn02_00258780 predicted 1922
8 SASI_Rn02_00258781 predicted 2327
9 SASI_Rn02_00258782 predicted 2032
10 SASI_Rn02_00258783 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314179 predicted 843
2 SASI_Rn02_00314180 predicted 820
3 SASI_Rn02_00314181 predicted 2198
4 SASI_Rn02_00314182 predicted 1929
5 SASI_Rn02_00314183 predicted 2028
6 SASI_Rn02_00314184 predicted 2448
7 SASI_Rn02_00314185 predicted 1925
8 SASI_Rn02_00314186 predicted 2332
9 SASI_Rn02_00314187 predicted 2025
10 SASI_Rn02_00314188 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296777 predicted 2478
2 SASI_Mm02_00296778 predicted 1961
3 SASI_Mm02_00296779 predicted 1958
4 SASI_Mm02_00296780 predicted 2265
5 SASI_Mm02_00296781 predicted 1291
6 SASI_Mm02_00296782 predicted 1600
7 SASI_Mm02_00296783 predicted 1959
8 SASI_Mm02_00296784 predicted 2359
9 SASI_Mm02_00296785 predicted 2169
10 SASI_Mm02_00296786 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276900 predicted 2484
2 SASI_Mm01_00276901 predicted 2416
3 SASI_Mm01_00276902 predicted 3038
4 SASI_Mm01_00276903 predicted 2270
5 SASI_Mm01_00276904 predicted 2265
6 SASI_Mm01_00276905 predicted 3035
7 SASI_Mm01_00276906 predicted 2358
8 SASI_Mm01_00276907 predicted 2997
9 SASI_Mm01_00276908 predicted 2362
10 SASI_Mm01_00276909 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259316 predicted 910
2 SASI_Mm01_00259317 predicted 857
3 SASI_Mm01_00259318 predicted 1463
4 SASI_Mm01_00259319 predicted 702
5 SASI_Mm01_00259320 predicted 705
6 SASI_Mm01_00259321 predicted 1474
7 SASI_Mm01_00259322 predicted 799
8 SASI_Mm01_00259323 predicted 1426
9 SASI_Mm01_00259324 predicted 788
10 SASI_Mm01_00259325 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081265
HEATR2 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1947s21c1
Sequence:CCGGGGGACAGTTCCGTGGCTATTTCTCGAGAAATAGCCACGGAACTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1306s21c1
Sequence:CCGGTTTGTCAGCCCAGAAGTATTTCTCGAGAAATACTTCTGGGCTGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-972s21c1
Sequence:CCGGGGAGAACGAGGCAGATCTAAACTCGAGTTTAGATCTGCCTCGTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081265.1-2895s21c1
Sequence:CCGGAGGAAAGCCAAAGGATTATAACTCGAGTTATAATCCTTTGGCTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1102s21c1
Sequence:CCGGCCTGCCATCTGTCATGATATCCTCGAGGATATCATGACAGATGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081265
HEATR2 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1947s21c1
Sequence:CCGGGGGACAGTTCCGTGGCTATTTCTCGAGAAATAGCCACGGAACTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1306s21c1
Sequence:CCGGTTTGTCAGCCCAGAAGTATTTCTCGAGAAATACTTCTGGGCTGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-972s21c1
Sequence:CCGGGGAGAACGAGGCAGATCTAAACTCGAGTTTAGATCTGCCTCGTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081265.1-2895s21c1
Sequence:CCGGAGGAAAGCCAAAGGATTATAACTCGAGTTATAATCCTTTGGCTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1102s21c1
Sequence:CCGGCCTGCCATCTGTCATGATATCCTCGAGGATATCATGACAGATGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081265
HEATR2 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1947s21c1
Sequence:CCGGGGGACAGTTCCGTGGCTATTTCTCGAGAAATAGCCACGGAACTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1306s21c1
Sequence:CCGGTTTGTCAGCCCAGAAGTATTTCTCGAGAAATACTTCTGGGCTGACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-972s21c1
Sequence:CCGGGGAGAACGAGGCAGATCTAAACTCGAGTTTAGATCTGCCTCGTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081265.1-2895s21c1
Sequence:CCGGAGGAAAGCCAAAGGATTATAACTCGAGTTATAATCCTTTGGCTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081265.1-1102s21c1
Sequence:CCGGCCTGCCATCTGTCATGATATCCTCGAGGATATCATGACAGATGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017802
VALIDATED
HEATR2 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017802.2-2980s1c1
Sequence:CCGGGCCAAAGTGATTAGAAAGAAACTCGAGTTTCTTTCTAATCACTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017802.2-2172s1c1
Sequence:CCGGCGACTGATCTCATGCCGTATTCTCGAGAATACGGCATGAGATCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2173s1c1
Sequence:CCGGGACTGATCTCATGCCGTATTACTCGAGTAATACGGCATGAGATCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-3222s1c1
Sequence:CCGGGCAGGAAAGTAAAGTTGCATTCTCGAGAATGCAACTTTACTTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2631s1c1
Sequence:CCGGGCCAGAGTTTGTGGCATTTAACTCGAGTTAAATGCCACAAACTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2246s1c1
Sequence:CCGGCAGGATTTATCCTGAACTCTTCTCGAGAAGAGTTCAGGATAAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017802
VALIDATED
HEATR2 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017802.2-2980s1c1
Sequence:CCGGGCCAAAGTGATTAGAAAGAAACTCGAGTTTCTTTCTAATCACTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017802.2-2172s1c1
Sequence:CCGGCGACTGATCTCATGCCGTATTCTCGAGAATACGGCATGAGATCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2173s1c1
Sequence:CCGGGACTGATCTCATGCCGTATTACTCGAGTAATACGGCATGAGATCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-3222s1c1
Sequence:CCGGGCAGGAAAGTAAAGTTGCATTCTCGAGAATGCAACTTTACTTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2631s1c1
Sequence:CCGGGCCAGAGTTTGTGGCATTTAACTCGAGTTAAATGCCACAAACTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2246s1c1
Sequence:CCGGCAGGATTTATCCTGAACTCTTCTCGAGAAGAGTTCAGGATAAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017802
VALIDATED
HEATR2 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017802.2-2980s1c1
Sequence:CCGGGCCAAAGTGATTAGAAAGAAACTCGAGTTTCTTTCTAATCACTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017802.2-2172s1c1
Sequence:CCGGCGACTGATCTCATGCCGTATTCTCGAGAATACGGCATGAGATCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2173s1c1
Sequence:CCGGGACTGATCTCATGCCGTATTACTCGAGTAATACGGCATGAGATCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-3222s1c1
Sequence:CCGGGCAGGAAAGTAAAGTTGCATTCTCGAGAATGCAACTTTACTTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2631s1c1
Sequence:CCGGGCCAGAGTTTGTGGCATTTAACTCGAGTTAAATGCCACAAACTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017802.2-2246s1c1
Sequence:CCGGCAGGATTTATCCTGAACTCTTCTCGAGAAGAGTTCAGGATAAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)