EMAIL THIS PAGE TO A FRIEND

HEATR3

HEAT repeat containing 3

56 Gene Product Result for
Synonyms: SYO1
UniProtKB ID: Q7Z4Q2, A8K1N4, Q8N525, Q8WV56, Q96CC9, Q9NWN7
Gene ID:
Mouse(234549) HEAT repeat containing 3
Rat(361375) HEAT repeat containing 3
Zebrafish(393863) HEAT repeat containing 3
cow(539353) HEAT repeat containing 3
Horse(100058410) HEAT repeat containing 3
chicken(415734) HEAT repeat containing 3
dog(478132) HEAT repeat containing 3
domestic cat(101095868) HEAT repeat containing 3
sheep(101112412) HEAT repeat containing 3
domestic guinea pig(100726430) HEAT repeat containing 3
naked mole-rat(101713807) HEAT repeat containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182922 Rosetta Predictions human pricing
XM_001067127 Rosetta Predictions rat pricing
XM_341654 Rosetta Predictions rat pricing
NM_172757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371042 predicted 905
2 SASI_Hs01_00061946 predicted 500
3 SASI_Hs01_00061947 predicted 1043
4 SASI_Hs02_00371043 predicted 964
5 SASI_Hs01_00061948 predicted 1050
6 SASI_Hs01_00061949 predicted 1404
7 SASI_Hs01_00061952 predicted 1322
8 SASI_Hs01_00061953 predicted 1506
9 SASI_Hs01_00061954 predicted 512
10 SASI_Hs02_00371044 predicted 682
11 SASI_Hs01_00061945 predicted 1344
12 SASI_Hs01_00061950 predicted 1820
13 SASI_Hs01_00061951 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319938 predicted 940
2 SASI_Rn02_00319939 predicted 1396
3 SASI_Rn02_00319940 predicted 666
4 SASI_Rn02_00319941 predicted 1481
5 SASI_Rn02_00319942 predicted 1191
6 SASI_Rn02_00319943 predicted 936
7 SASI_Rn02_00319944 predicted 1560
8 SASI_Rn02_00319945 predicted 1876
9 SASI_Rn02_00319946 predicted 713
10 SASI_Rn02_00319947 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393221 predicted 947
2 SASI_Rn02_00393222 predicted 1398
3 SASI_Rn02_00393223 predicted 1446
4 SASI_Rn02_00393224 predicted 958
5 SASI_Rn02_00393225 predicted 1796
6 SASI_Rn02_00393226 predicted 1479
7 SASI_Rn02_00393227 predicted 1197
8 SASI_Rn02_00393228 predicted 932
9 SASI_Rn02_00393229 predicted 1562
10 SASI_Rn02_00393230 predicted 1878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065434 predicted 1404
2 SASI_Mm01_00065436 predicted 950
3 SASI_Mm01_00065437 predicted 2023
4 SASI_Mm01_00065438 predicted 1109
5 SASI_Mm01_00065439 predicted 967
6 SASI_Mm02_00344621 predicted 1472
7 SASI_Mm01_00065441 predicted 2114
8 SASI_Mm01_00065442 predicted 1363
9 SASI_Mm01_00065443 predicted 695
10 SASI_Mm02_00344622 predicted 856
11 SASI_Mm01_00065435 predicted 902
12 SASI_Mm01_00065440 predicted 1993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017939
VALIDATED
HEATR3 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017939.1-2162s1c1
Sequence:CCGGCGATGAGATCTGTGTGGCATTCTCGAGAATGCCACACAGATCTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017939.1-1135s1c1
Sequence:CCGGGCAGTGATGAAAGTGACGCATCTCGAGATGCGTCACTTTCATCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-1680s1c1
Sequence:CCGGGCCAAAGAAGATGGTACACTTCTCGAGAAGTGTACCATCTTCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017939.1-729s1c1
Sequence:CCGGGCAGGCACAATTTGGAATCTACTCGAGTAGATTCCAAATTGTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-730s1c1
Sequence:CCGGCAGGCACAATTTGGAATCTAACTCGAGTTAGATTCCAAATTGTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017939.1-2289s1c1
Sequence:CCGGCCAGCAGTGAAGAAACTTCAACTCGAGTTGAAGTTTCTTCACTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-1730s1c1
Sequence:CCGGGCTTGAAGTTACCACCAAAGACTCGAGTCTTTGGTGGTAACTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017939.1-2349s1c1
Sequence:CCGGCCAAAGCATTGCTTGGATGTTCTCGAGAACATCCAAGCAATGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017939.1-1313s1c1
Sequence:CCGGGAACCCTACTTGGAAACCTTTCTCGAGAAAGGTTTCCAAGTAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-654s1c1
Sequence:CCGGGCATTGAACATGCTGGAATCACTCGAGTGATTCCAGCATGTTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017939
VALIDATED
HEATR3 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017939.1-2162s1c1
Sequence:CCGGCGATGAGATCTGTGTGGCATTCTCGAGAATGCCACACAGATCTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017939.1-1135s1c1
Sequence:CCGGGCAGTGATGAAAGTGACGCATCTCGAGATGCGTCACTTTCATCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-1680s1c1
Sequence:CCGGGCCAAAGAAGATGGTACACTTCTCGAGAAGTGTACCATCTTCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017939.1-729s1c1
Sequence:CCGGGCAGGCACAATTTGGAATCTACTCGAGTAGATTCCAAATTGTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-730s1c1
Sequence:CCGGCAGGCACAATTTGGAATCTAACTCGAGTTAGATTCCAAATTGTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017939.1-2289s1c1
Sequence:CCGGCCAGCAGTGAAGAAACTTCAACTCGAGTTGAAGTTTCTTCACTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-1730s1c1
Sequence:CCGGGCTTGAAGTTACCACCAAAGACTCGAGTCTTTGGTGGTAACTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017939.1-2349s1c1
Sequence:CCGGCCAAAGCATTGCTTGGATGTTCTCGAGAACATCCAAGCAATGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017939.1-1313s1c1
Sequence:CCGGGAACCCTACTTGGAAACCTTTCTCGAGAAAGGTTTCCAAGTAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-654s1c1
Sequence:CCGGGCATTGAACATGCTGGAATCACTCGAGTGATTCCAGCATGTTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017939
VALIDATED
HEATR3 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017939.1-2162s1c1
Sequence:CCGGCGATGAGATCTGTGTGGCATTCTCGAGAATGCCACACAGATCTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017939.1-1135s1c1
Sequence:CCGGGCAGTGATGAAAGTGACGCATCTCGAGATGCGTCACTTTCATCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-1680s1c1
Sequence:CCGGGCCAAAGAAGATGGTACACTTCTCGAGAAGTGTACCATCTTCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017939.1-729s1c1
Sequence:CCGGGCAGGCACAATTTGGAATCTACTCGAGTAGATTCCAAATTGTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-730s1c1
Sequence:CCGGCAGGCACAATTTGGAATCTAACTCGAGTTAGATTCCAAATTGTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017939.1-2289s1c1
Sequence:CCGGCCAGCAGTGAAGAAACTTCAACTCGAGTTGAAGTTTCTTCACTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-1730s1c1
Sequence:CCGGGCTTGAAGTTACCACCAAAGACTCGAGTCTTTGGTGGTAACTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017939.1-2349s1c1
Sequence:CCGGCCAAAGCATTGCTTGGATGTTCTCGAGAACATCCAAGCAATGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017939.1-1313s1c1
Sequence:CCGGGAACCCTACTTGGAAACCTTTCTCGAGAAAGGTTTCCAAGTAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017939.1-654s1c1
Sequence:CCGGGCATTGAACATGCTGGAATCACTCGAGTGATTCCAGCATGTTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172757
VALIDATED
HEATR3 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-580s1c1
Sequence:CCGGGCTGATAAGAGAAATCCTGTACTCGAGTACAGGATTTCTCTTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-1799s1c1
Sequence:CCGGGAGTGAATGTGGTCAGTATTTCTCGAGAAATACTGACCACATTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-2440s1c1
Sequence:CCGGGCTGGGCTTTAAGGTATTCAACTCGAGTTGAATACCTTAAAGCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-1078s1c1
Sequence:CCGGGCTAACGGTGATGACTTGGTTCTCGAGAACCAAGTCATCACCGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-2305s1c1
Sequence:CCGGGCTGAGAATACTGAAGGGTTTCTCGAGAAACCCTTCAGTATTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-1798s1c1
Sequence:CCGGCGAGTGAATGTGGTCAGTATTCTCGAGAATACTGACCACATTCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-1222s1c1
Sequence:CCGGCAGACTGCTCTGGAAGTTATTCTCGAGAATAACTTCCAGAGCAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-933s1c1
Sequence:CCGGGAGTCAGGCAGAAATCATTAACTCGAGTTAATGATTTCTGCCTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172757
VALIDATED
HEATR3 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-580s1c1
Sequence:CCGGGCTGATAAGAGAAATCCTGTACTCGAGTACAGGATTTCTCTTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-1799s1c1
Sequence:CCGGGAGTGAATGTGGTCAGTATTTCTCGAGAAATACTGACCACATTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-2440s1c1
Sequence:CCGGGCTGGGCTTTAAGGTATTCAACTCGAGTTGAATACCTTAAAGCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-1078s1c1
Sequence:CCGGGCTAACGGTGATGACTTGGTTCTCGAGAACCAAGTCATCACCGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-2305s1c1
Sequence:CCGGGCTGAGAATACTGAAGGGTTTCTCGAGAAACCCTTCAGTATTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-1798s1c1
Sequence:CCGGCGAGTGAATGTGGTCAGTATTCTCGAGAATACTGACCACATTCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-1222s1c1
Sequence:CCGGCAGACTGCTCTGGAAGTTATTCTCGAGAATAACTTCCAGAGCAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-933s1c1
Sequence:CCGGGAGTCAGGCAGAAATCATTAACTCGAGTTAATGATTTCTGCCTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172757
VALIDATED
HEATR3 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-580s1c1
Sequence:CCGGGCTGATAAGAGAAATCCTGTACTCGAGTACAGGATTTCTCTTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-1799s1c1
Sequence:CCGGGAGTGAATGTGGTCAGTATTTCTCGAGAAATACTGACCACATTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-2440s1c1
Sequence:CCGGGCTGGGCTTTAAGGTATTCAACTCGAGTTGAATACCTTAAAGCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-1078s1c1
Sequence:CCGGGCTAACGGTGATGACTTGGTTCTCGAGAACCAAGTCATCACCGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-2305s1c1
Sequence:CCGGGCTGAGAATACTGAAGGGTTTCTCGAGAAACCCTTCAGTATTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172757.3-1798s1c1
Sequence:CCGGCGAGTGAATGTGGTCAGTATTCTCGAGAATACTGACCACATTCACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-1222s1c1
Sequence:CCGGCAGACTGCTCTGGAAGTTATTCTCGAGAATAACTTCCAGAGCAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172757.3-933s1c1
Sequence:CCGGGAGTCAGGCAGAAATCATTAACTCGAGTTAATGATTTCTGCCTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)