EMAIL THIS PAGE TO A FRIEND

HEATR5A

HEAT repeat containing 5A

48 Gene Product Result for
Synonyms: C14orf125
Gene ID:
Mouse(320487) HEAT repeat containing 5A
Rat(362737) HEAT repeat containing 5A
Zebrafish(368728) HEAT repeat containing 5a
cow(507297) HEAT repeat containing 5A
domestic cat(101081812) HEAT repeat containing 5A
dog(480285) HEAT repeat containing 5A
chicken(423311) HEAT repeat containing 5A
sheep(101115909) HEAT repeat containing 5A
Domestic Rabbit(100357599) HEAT repeat containing 5A
domestic guinea pig(100733385) HEAT repeat containing 5A
naked mole-rat(101699534) HEAT repeat containing 5A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049539 Anti-HEATR5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015473 Rosetta Predictions human pricing
XM_001075318 Rosetta Predictions rat pricing
XM_343061 Rosetta Predictions rat pricing
NM_177171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347905 predicted 2520
2 SASI_Hs02_00347906 predicted 4088
3 SASI_Hs02_00347907 predicted 4337
4 SASI_Hs02_00347908 predicted 1994
5 SASI_Hs02_00347909 predicted 3095
6 SASI_Hs02_00347910 predicted 3270
7 SASI_Hs02_00347911 predicted 2883
8 SASI_Hs02_00347912 predicted 2082
9 SASI_Hs02_00347913 predicted 4065
10 SASI_Hs02_00347914 predicted 2792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349310 predicted 6164
2 SASI_Rn02_00349311 predicted 5684
3 SASI_Rn02_00349312 predicted 5797
4 SASI_Rn02_00349313 predicted 4999
5 SASI_Rn02_00349314 predicted 469
6 SASI_Rn02_00349315 predicted 2473
7 SASI_Rn02_00349316 predicted 1389
8 SASI_Rn02_00349317 predicted 1453
9 SASI_Rn02_00349318 predicted 3243
10 SASI_Rn02_00349319 predicted 6295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395251 predicted 6163
2 SASI_Rn02_00395252 predicted 5680
3 SASI_Rn02_00395253 predicted 5794
4 SASI_Rn02_00395254 predicted 5001
5 SASI_Rn02_00395255 predicted 465
6 SASI_Rn02_00395256 predicted 2477
7 SASI_Rn02_00395257 predicted 1395
8 SASI_Rn02_00395258 predicted 1452
9 SASI_Rn02_00395259 predicted 3250
10 SASI_Rn02_00395260 predicted 6289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347158 predicted 4992
2 SASI_Mm02_00347159 predicted 1673
3 SASI_Mm02_00347160 predicted 4475
4 SASI_Mm02_00347161 predicted 1204
5 SASI_Mm02_00347162 predicted 1374
6 SASI_Mm02_00347163 predicted 2886
7 SASI_Mm02_00347164 predicted 5064
8 SASI_Mm02_00347165 predicted 2547
9 SASI_Mm02_00347166 predicted 885
10 SASI_Mm02_00347167 predicted 2201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177171
VALIDATED
HEATR5A MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 5A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177171.3-6706s1c1
Sequence:CCGGCGTATCAAACTGTGTTGCATTCTCGAGAATGCAACACAGTTTGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.3-904s1c1
Sequence:CCGGCGTGCGGATATCAGTTTCAAACTCGAGTTTGAAACTGATATCCGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.3-5536s1c1
Sequence:CCGGGCAGACTCTGAAAGGAATCTTCTCGAGAAGATTCCTTTCAGAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-2889s21c1
Sequence:CCGGCTCAACTTAGCTTCGACAAATCTCGAGATTTGTCGAAGCTAAGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-7480s21c1
Sequence:CCGGTTTGGCTGTTTACGATCATTTCTCGAGAAATGATCGTAAACAGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-5028s21c1
Sequence:CCGGATGTACTACACCGAGTAATTTCTCGAGAAATTACTCGGTGTAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-2252s21c1
Sequence:CCGGTTACCTCCTGAGACCTATAAACTCGAGTTTATAGGTCTCAGGAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.4-2227s1c1
Sequence:CCGGGAGACTTTATGAACTACTAATCTCGAGATTAGTAGTTCATAAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.4-2372s1c1
Sequence:CCGGCCGGATGACCTCTTGATATTACTCGAGTAATATCAAGAGGTCATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177171
VALIDATED
HEATR5A MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 5A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177171.3-6706s1c1
Sequence:CCGGCGTATCAAACTGTGTTGCATTCTCGAGAATGCAACACAGTTTGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.3-904s1c1
Sequence:CCGGCGTGCGGATATCAGTTTCAAACTCGAGTTTGAAACTGATATCCGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.3-5536s1c1
Sequence:CCGGGCAGACTCTGAAAGGAATCTTCTCGAGAAGATTCCTTTCAGAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-2889s21c1
Sequence:CCGGCTCAACTTAGCTTCGACAAATCTCGAGATTTGTCGAAGCTAAGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-7480s21c1
Sequence:CCGGTTTGGCTGTTTACGATCATTTCTCGAGAAATGATCGTAAACAGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-5028s21c1
Sequence:CCGGATGTACTACACCGAGTAATTTCTCGAGAAATTACTCGGTGTAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-2252s21c1
Sequence:CCGGTTACCTCCTGAGACCTATAAACTCGAGTTTATAGGTCTCAGGAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.4-2227s1c1
Sequence:CCGGGAGACTTTATGAACTACTAATCTCGAGATTAGTAGTTCATAAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.4-2372s1c1
Sequence:CCGGCCGGATGACCTCTTGATATTACTCGAGTAATATCAAGAGGTCATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177171
VALIDATED
HEATR5A MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 5A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177171.3-6706s1c1
Sequence:CCGGCGTATCAAACTGTGTTGCATTCTCGAGAATGCAACACAGTTTGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.3-904s1c1
Sequence:CCGGCGTGCGGATATCAGTTTCAAACTCGAGTTTGAAACTGATATCCGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.3-5536s1c1
Sequence:CCGGGCAGACTCTGAAAGGAATCTTCTCGAGAAGATTCCTTTCAGAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-2889s21c1
Sequence:CCGGCTCAACTTAGCTTCGACAAATCTCGAGATTTGTCGAAGCTAAGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-7480s21c1
Sequence:CCGGTTTGGCTGTTTACGATCATTTCTCGAGAAATGATCGTAAACAGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-5028s21c1
Sequence:CCGGATGTACTACACCGAGTAATTTCTCGAGAAATTACTCGGTGTAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177171.4-2252s21c1
Sequence:CCGGTTACCTCCTGAGACCTATAAACTCGAGTTTATAGGTCTCAGGAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.4-2227s1c1
Sequence:CCGGGAGACTTTATGAACTACTAATCTCGAGATTAGTAGTTCATAAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177171.4-2372s1c1
Sequence:CCGGCCGGATGACCTCTTGATATTACTCGAGTAATATCAAGAGGTCATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015473
VALIDATED
HEATR5A MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 5A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-6157s21c1
Sequence:CCGGCCAGTATACAATAGTACAAATCTCGAGATTTGTACTATTGTATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-4445s21c1
Sequence:CCGGCTCAATTCTCCCTACTATATTCTCGAGAATATAGTAGGGAGAATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-4039s21c1
Sequence:CCGGATGTTCTACATCGAGTAATTTCTCGAGAAATTACTCGATGTAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-1473s21c1
Sequence:CCGGTATGACCCTTATTCGATTTATCTCGAGATAAATCGAATAAGGGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-2103s21c1
Sequence:CCGGTCTGCTGGCCCACTCTATTATCTCGAGATAATAGAGTGGGCCAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015473
VALIDATED
HEATR5A MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 5A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-6157s21c1
Sequence:CCGGCCAGTATACAATAGTACAAATCTCGAGATTTGTACTATTGTATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-4445s21c1
Sequence:CCGGCTCAATTCTCCCTACTATATTCTCGAGAATATAGTAGGGAGAATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-4039s21c1
Sequence:CCGGATGTTCTACATCGAGTAATTTCTCGAGAAATTACTCGATGTAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-1473s21c1
Sequence:CCGGTATGACCCTTATTCGATTTATCTCGAGATAAATCGAATAAGGGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-2103s21c1
Sequence:CCGGTCTGCTGGCCCACTCTATTATCTCGAGATAATAGAGTGGGCCAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015473
VALIDATED
HEATR5A MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 5A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-6157s21c1
Sequence:CCGGCCAGTATACAATAGTACAAATCTCGAGATTTGTACTATTGTATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-4445s21c1
Sequence:CCGGCTCAATTCTCCCTACTATATTCTCGAGAATATAGTAGGGAGAATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-4039s21c1
Sequence:CCGGATGTTCTACATCGAGTAATTTCTCGAGAAATTACTCGATGTAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-1473s21c1
Sequence:CCGGTATGACCCTTATTCGATTTATCTCGAGATAAATCGAATAAGGGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015473.2-2103s21c1
Sequence:CCGGTCTGCTGGCCCACTCTATTATCTCGAGATAATAGAGTGGGCCAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)