EMAIL THIS PAGE TO A FRIEND

HEATR5B

HEAT repeat containing 5B

91 Gene Product Result for
UniProtKB ID: Q9P2D3, B5MDU8, Q7Z3B2, Q9NVL7
Gene ID:
Mouse(320473) HEAT repeat containing 5B
Rat(362683) HEAT repeat containing 5B
domestic guinea pig(100717108) HEAT repeat containing 5B
naked mole-rat(101723059) HEAT repeat containing 5B
sheep(101122344) HEAT repeat containing 5B
Zebrafish(571772) HEAT repeat containing 5B
Horse(100054373) HEAT repeat containing 5B
chicken(421469) HEAT repeat containing 5B
dog(483033) HEAT repeat containing 5B
domestic cat(101080778) HEAT repeat containing 5B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019024 Rosetta Predictions human pricing
XM_001053592 Rosetta Predictions rat pricing
NM_001081179 Rosetta Predictions mouse pricing
XM_283480 Rosetta Predictions mouse pricing
XM_898311 Rosetta Predictions mouse pricing
XM_898330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352570 predicted 5231
2 SASI_Hs02_00352571 predicted 4850
3 SASI_Hs02_00352572 predicted 3480
4 SASI_Hs02_00352573 predicted 211
5 SASI_Hs02_00352574 predicted 4470
6 SASI_Hs01_00177839 predicted 4171
7 SASI_Hs01_00177840 predicted 2761
8 SASI_Hs02_00352575 predicted 867
9 SASI_Hs01_00177842 predicted 5421
10 SASI_Hs01_00177844 predicted 4568
11 SASI_Hs01_00177837 predicted 5045
12 SASI_Hs01_00177838 predicted 4159
13 SASI_Hs01_00177841 predicted 565
14 SASI_Hs01_00177843 predicted 2792
15 SASI_Hs01_00177845 predicted 668
16 SASI_Hs01_00177846 predicted 3167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272900 predicted 5640
2 SASI_Rn02_00272901 predicted 1759
3 SASI_Rn02_00272902 predicted 5932
4 SASI_Rn02_00272903 predicted 4943
5 SASI_Rn02_00272904 predicted 6084
6 SASI_Rn02_00272905 predicted 231
7 SASI_Rn02_00272906 predicted 4451
8 SASI_Rn02_00272907 predicted 4285
9 SASI_Rn02_00272908 predicted 2800
10 SASI_Rn02_00272909 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295961 predicted 2479
2 SASI_Mm02_00295962 predicted 1590
3 SASI_Mm02_00295963 predicted 6113
4 SASI_Mm02_00295964 predicted 5571
5 SASI_Mm02_00295965 predicted 4577
6 SASI_Mm02_00295966 predicted 805
7 SASI_Mm02_00295967 predicted 911
8 SASI_Mm02_00295968 predicted 2886
9 SASI_Mm02_00295969 predicted 2284
10 SASI_Mm02_00295970 predicted 5421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254767 predicted 2490
2 SASI_Mm01_00254768 predicted 1792
3 SASI_Mm01_00254769 predicted 2289
4 SASI_Mm01_00254770 predicted 1593
5 SASI_Mm01_00254771 predicted 809
6 SASI_Mm01_00254772 predicted 2103
7 SASI_Mm01_00254773 predicted 1673
8 SASI_Mm01_00254774 predicted 914
9 SASI_Mm01_00254775 predicted 2892
10 SASI_Mm01_00254776 predicted 2286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234000 predicted 1788
2 SASI_Mm01_00234001 predicted 499
3 SASI_Mm01_00234002 predicted 1599
4 SASI_Mm01_00234003 predicted 2044
5 SASI_Mm01_00234004 predicted 2194
6 SASI_Mm01_00234005 predicted 813
7 SASI_Mm01_00234006 predicted 2105
8 SASI_Mm01_00234007 predicted 1673
9 SASI_Mm01_00234008 predicted 907
10 SASI_Mm01_00234009 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258262 predicted 2482
2 SASI_Mm01_00258263 predicted 1783
3 SASI_Mm01_00258264 predicted 2290
4 SASI_Mm01_00258265 predicted 1594
5 SASI_Mm01_00258266 predicted 807
6 SASI_Mm01_00258267 predicted 2110
7 SASI_Mm01_00258268 predicted 1677
8 SASI_Mm01_00258269 predicted 913
9 SASI_Mm01_00258270 predicted 2893
10 SASI_Mm01_00258271 predicted 2286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019024
VALIDATED
HEATR5B MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 5B
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-2091s21c1
Sequence:CCGGTGCTGCAATGGTCCGTTTAAGCTCGAGCTTAAACGGACCATTGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-2762s21c1
Sequence:CCGGTTGCTAGAATGGCCCAATATACTCGAGTATATTGGGCCATTCTAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-1590s21c1
Sequence:CCGGAGAAGCTGTCAGTGGATATAGCTCGAGCTATATCCACTGACAGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-609s21c1
Sequence:CCGGAGCTTCCTCCCATCGTGATATCTCGAGATATCACGATGGGAGGAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-4576s21c1
Sequence:CCGGTTGACTTTACCAGCCGAATTTCTCGAGAAATTCGGCTGGTAAAGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-3505s21c1
Sequence:CCGGTGCCGGCACCAAGGTGTTAATCTCGAGATTAACACCTTGGTGCCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019024.1-6562s21c1
Sequence:CCGGTTCAAACACTGAGCCATAGTCCTCGAGGACTATGGCTCAGTGTTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-1669s1c1
Sequence:CCGGGCCAAAGGAAAGATGGTAGTTCTCGAGAACTACCATCTTTCCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-6429s1c1
Sequence:CCGGGCTTCCAAGTAGGTTAAGTGACTCGAGTCACTTAACCTACTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-2853s1c1
Sequence:CCGGGCATCGTTATGTTGGTGGAATCTCGAGATTCCACCAACATAACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_019024.1-4697s1c1
Sequence:CCGGCGGTGGCACTTTGGTTAAATACTCGAGTATTTAACCAAAGTGCCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_019024.1-491s1c1
Sequence:CCGGGCGCATTTCCAGAAACGGTAACTCGAGTTACCGTTTCTGGAAATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-889s1c1
Sequence:CCGGGCAACATTTGATGAAGTCTTACTCGAGTAAGACTTCATCAAATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-3011s1c1
Sequence:CCGGGCTATGTGGAACCAACATTATCTCGAGATAATGTTGGTTCCACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019024.1-6523s1c1
Sequence:CCGGCCTCCTAATAATGTTTCTCTTCTCGAGAAGAGAAACATTATTAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-493s1c1
Sequence:CCGGGCATTTCCAGAAACGGTAAATCTCGAGATTTACCGTTTCTGGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019024.1-6448s1c1
Sequence:CCGGGAAATAATGCTCACACCACTTCTCGAGAAGTGGTGTGAGCATTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019024
VALIDATED
HEATR5B MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 5B
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-2091s21c1
Sequence:CCGGTGCTGCAATGGTCCGTTTAAGCTCGAGCTTAAACGGACCATTGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-2762s21c1
Sequence:CCGGTTGCTAGAATGGCCCAATATACTCGAGTATATTGGGCCATTCTAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-1590s21c1
Sequence:CCGGAGAAGCTGTCAGTGGATATAGCTCGAGCTATATCCACTGACAGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-609s21c1
Sequence:CCGGAGCTTCCTCCCATCGTGATATCTCGAGATATCACGATGGGAGGAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-4576s21c1
Sequence:CCGGTTGACTTTACCAGCCGAATTTCTCGAGAAATTCGGCTGGTAAAGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-3505s21c1
Sequence:CCGGTGCCGGCACCAAGGTGTTAATCTCGAGATTAACACCTTGGTGCCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019024.1-6562s21c1
Sequence:CCGGTTCAAACACTGAGCCATAGTCCTCGAGGACTATGGCTCAGTGTTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-1669s1c1
Sequence:CCGGGCCAAAGGAAAGATGGTAGTTCTCGAGAACTACCATCTTTCCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-6429s1c1
Sequence:CCGGGCTTCCAAGTAGGTTAAGTGACTCGAGTCACTTAACCTACTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-2853s1c1
Sequence:CCGGGCATCGTTATGTTGGTGGAATCTCGAGATTCCACCAACATAACGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_019024.1-4697s1c1
Sequence:CCGGCGGTGGCACTTTGGTTAAATACTCGAGTATTTAACCAAAGTGCCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_019024.1-491s1c1
Sequence:CCGGGCGCATTTCCAGAAACGGTAACTCGAGTTACCGTTTCTGGAAATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-889s1c1
Sequence:CCGGGCAACATTTGATGAAGTCTTACTCGAGTAAGACTTCATCAAATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-3011s1c1
Sequence:CCGGGCTATGTGGAACCAACATTATCTCGAGATAATGTTGGTTCCACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019024.1-6523s1c1
Sequence:CCGGCCTCCTAATAATGTTTCTCTTCTCGAGAAGAGAAACATTATTAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-493s1c1
Sequence:CCGGGCATTTCCAGAAACGGTAAATCTCGAGATTTACCGTTTCTGGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019024.1-6448s1c1
Sequence:CCGGGAAATAATGCTCACACCACTTCTCGAGAAGTGGTGTGAGCATTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019024
VALIDATED
HEATR5B MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 5B
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-2091s21c1
Sequence:CCGGTGCTGCAATGGTCCGTTTAAGCTCGAGCTTAAACGGACCATTGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-2762s21c1
Sequence:CCGGTTGCTAGAATGGCCCAATATACTCGAGTATATTGGGCCATTCTAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-1590s21c1
Sequence:CCGGAGAAGCTGTCAGTGGATATAGCTCGAGCTATATCCACTGACAGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-609s21c1
Sequence:CCGGAGCTTCCTCCCATCGTGATATCTCGAGATATCACGATGGGAGGAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-4576s21c1
Sequence:CCGGTTGACTTTACCAGCCGAATTTCTCGAGAAATTCGGCTGGTAAAGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019024.1-3505s21c1
Sequence:CCGGTGCCGGCACCAAGGTGTTAATCTCGAGATTAACACCTTGGTGCCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019024.1-6562s21c1
Sequence:CCGGTTCAAACACTGAGCCATAGTCCTCGAGGACTATGGCTCAGTGTTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-1669s1c1
Sequence:CCGGGCCAAAGGAAAGATGGTAGTTCTCGAGAACTACCATCTTTCCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-6429s1c1
Sequence:CCGGGCTTCCAAGTAGGTTAAGTGACTCGAGTCACTTAACCTACTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-2853s1c1
Sequence:CCGGGCATCGTTATGTTGGTGGAATCTCGAGATTCCACCAACATAACGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_019024.1-4697s1c1
Sequence:CCGGCGGTGGCACTTTGGTTAAATACTCGAGTATTTAACCAAAGTGCCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_019024.1-491s1c1
Sequence:CCGGGCGCATTTCCAGAAACGGTAACTCGAGTTACCGTTTCTGGAAATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019024.1-889s1c1
Sequence:CCGGGCAACATTTGATGAAGTCTTACTCGAGTAAGACTTCATCAAATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-3011s1c1
Sequence:CCGGGCTATGTGGAACCAACATTATCTCGAGATAATGTTGGTTCCACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019024.1-6523s1c1
Sequence:CCGGCCTCCTAATAATGTTTCTCTTCTCGAGAAGAGAAACATTATTAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019024.1-493s1c1
Sequence:CCGGGCATTTCCAGAAACGGTAAATCTCGAGATTTACCGTTTCTGGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019024.1-6448s1c1
Sequence:CCGGGAAATAATGCTCACACCACTTCTCGAGAAGTGGTGTGAGCATTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081179
VALIDATED
HEATR5B MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 5B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-798s21c1
Sequence:CCGGGTACGAGTCGCAGTATCTAAGCTCGAGCTTAGATACTGCGACTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-551s21c1
Sequence:CCGGAGGGCGAAGTGAGATCTTAATCTCGAGATTAAGATCTCACTTCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-953s21c1
Sequence:CCGGCCTAAAGAGTGGCGGAGAAATCTCGAGATTTCTCCGCCACTCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-2845s21c1
Sequence:CCGGTCGGTTGTTTACATCGTTATGCTCGAGCATAACGATGTAAACAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081179.1-1981s21c1
Sequence:CCGGTGCTAACAGAGGATGCAATTACTCGAGTAATTGCATCCTCTGTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081179
VALIDATED
HEATR5B MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 5B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-798s21c1
Sequence:CCGGGTACGAGTCGCAGTATCTAAGCTCGAGCTTAGATACTGCGACTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-551s21c1
Sequence:CCGGAGGGCGAAGTGAGATCTTAATCTCGAGATTAAGATCTCACTTCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-953s21c1
Sequence:CCGGCCTAAAGAGTGGCGGAGAAATCTCGAGATTTCTCCGCCACTCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-2845s21c1
Sequence:CCGGTCGGTTGTTTACATCGTTATGCTCGAGCATAACGATGTAAACAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081179.1-1981s21c1
Sequence:CCGGTGCTAACAGAGGATGCAATTACTCGAGTAATTGCATCCTCTGTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081179
VALIDATED
HEATR5B MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 5B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-798s21c1
Sequence:CCGGGTACGAGTCGCAGTATCTAAGCTCGAGCTTAGATACTGCGACTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-551s21c1
Sequence:CCGGAGGGCGAAGTGAGATCTTAATCTCGAGATTAAGATCTCACTTCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-953s21c1
Sequence:CCGGCCTAAAGAGTGGCGGAGAAATCTCGAGATTTCTCCGCCACTCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081179.1-2845s21c1
Sequence:CCGGTCGGTTGTTTACATCGTTATGCTCGAGCATAACGATGTAAACAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081179.1-1981s21c1
Sequence:CCGGTGCTAACAGAGGATGCAATTACTCGAGTAATTGCATCCTCTGTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)