EMAIL THIS PAGE TO A FRIEND

HEATR6

HEAT repeat containing 6

110 Gene Product Result for
Synonyms: ABC1
Gene ID:
Mouse(217026) HEAT repeat containing 6
Rat(497972) HEAT repeat containing 6
chicken(417661) HEAT repeat containing 6
cow(515657) HEAT repeat containing 6
Horse(100071508) HEAT repeat containing 6
domestic cat(101081585) HEAT repeat containing 6
dog(480598) HEAT repeat containing 6
sheep(101113083) HEAT repeat containing 6
Domestic Rabbit(100355228) HEAT repeat containing 6
naked mole-rat(101728271) HEAT repeat containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022070 Rosetta Predictions human pricing
NM_001079897 Rosetta Predictions rat pricing
NM_145432 Rosetta Predictions mouse pricing
XM_354634 Rosetta Predictions mouse pricing
XM_902903 Rosetta Predictions mouse pricing
XM_902906 Rosetta Predictions mouse pricing
XM_902915 Rosetta Predictions mouse pricing
XM_902919 Rosetta Predictions mouse pricing
XM_902921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039885 predicted 1965
2 SASI_Hs01_00039886 predicted 3302
3 SASI_Hs01_00039887 predicted 381
4 SASI_Hs01_00039888 predicted 2884
5 SASI_Hs02_00355434 predicted 1975
6 SASI_Hs01_00039889 predicted 3023
7 SASI_Hs01_00039890 predicted 2745
8 SASI_Hs01_00039891 predicted 2082
9 SASI_Hs02_00355435 predicted 313
10 SASI_Hs01_00039892 predicted 2592
11 SASI_Hs01_00039893 predicted 2232
12 SASI_Hs01_00039894 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208279 predicted 697
2 SASI_Rn02_00208280 predicted 2892
3 SASI_Rn02_00208281 predicted 2164
4 SASI_Rn02_00208282 predicted 2811
5 SASI_Rn02_00208283 predicted 3523
6 SASI_Rn02_00208284 predicted 1936
7 SASI_Rn02_00208285 predicted 2388
8 SASI_Rn02_00208286 predicted 512
9 SASI_Rn02_00208287 predicted 807
10 SASI_Rn02_00208288 predicted 3113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340793 predicted 380
2 SASI_Mm02_00340794 predicted 1473
3 SASI_Mm02_00340795 predicted 2563
4 SASI_Mm02_00340796 predicted 3110
5 SASI_Mm02_00340797 predicted 2270
6 SASI_Mm02_00340798 predicted 3398
7 SASI_Mm02_00340799 predicted 2679
8 SASI_Mm02_00340800 predicted 3178
9 SASI_Mm02_00340801 predicted 1644
10 SASI_Mm02_00340802 predicted 2691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281500 predicted 1923
2 SASI_Mm01_00281501 predicted 3563
3 SASI_Mm01_00281502 predicted 2949
4 SASI_Mm01_00281503 predicted 2740
5 SASI_Mm01_00281504 predicted 1939
6 SASI_Mm01_00281505 predicted 3273
7 SASI_Mm01_00281506 predicted 2436
8 SASI_Mm01_00281507 predicted 3569
9 SASI_Mm01_00281508 predicted 2849
10 SASI_Mm01_00281509 predicted 3351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265602 predicted 1917
2 SASI_Mm01_00265603 predicted 556
3 SASI_Mm01_00265604 predicted 1636
4 SASI_Mm01_00265605 predicted 523
5 SASI_Mm01_00265606 predicted 1948
6 SASI_Mm01_00265607 predicted 684
7 SASI_Mm01_00265608 predicted 1813
8 SASI_Mm01_00265609 predicted 802
9 SASI_Mm01_00265610 predicted 848
10 SASI_Mm01_00265611 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216579 predicted 885
2 SASI_Mm01_00216580 predicted 785
3 SASI_Mm01_00216581 predicted 844
4 SASI_Mm01_00216582 predicted 620
5 SASI_Mm01_00216583 predicted 955
6 SASI_Mm01_00216584 predicted 705
7 SASI_Mm01_00216585 predicted 983
8 SASI_Mm01_00216586 predicted 938
9 SASI_Mm01_00216587 predicted 336
10 SASI_Mm01_00216588 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273451 predicted 1919
2 SASI_Mm01_00273452 predicted 1883
3 SASI_Mm01_00273453 predicted 1815
4 SASI_Mm01_00273454 predicted 1946
5 SASI_Mm01_00273455 predicted 1718
6 SASI_Mm01_00273456 predicted 1813
7 SASI_Mm01_00273457 predicted 2008
8 SASI_Mm01_00273458 predicted 1967
9 SASI_Mm01_00273459 predicted 1976
10 SASI_Mm01_00273460 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215377 predicted 3181
2 SASI_Mm01_00215378 predicted 4820
3 SASI_Mm01_00215379 predicted 4206
4 SASI_Mm01_00215380 predicted 3995
5 SASI_Mm01_00215381 predicted 3200
6 SASI_Mm01_00215382 predicted 4535
7 SASI_Mm01_00215383 predicted 3697
8 SASI_Mm01_00215384 predicted 4837
9 SASI_Mm01_00215385 predicted 4108
10 SASI_Mm01_00215386 predicted 4617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268283 predicted 1884
2 SASI_Mm01_00268284 predicted 3520
3 SASI_Mm01_00268285 predicted 2911
4 SASI_Mm01_00268286 predicted 2703
5 SASI_Mm01_00268287 predicted 1911
6 SASI_Mm01_00268288 predicted 3246
7 SASI_Mm01_00268289 predicted 2410
8 SASI_Mm01_00268290 predicted 3536
9 SASI_Mm01_00268291 predicted 2820
10 SASI_Mm01_00268292 predicted 3320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022070
VALIDATED
HEATR6 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-3641s1c1
Sequence:CCGGGCAGAAACAATCCGTTCACTACTCGAGTAGTGAACGGATTGTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-830s1c1
Sequence:CCGGCCCTGGACTAAACATAGAGATCTCGAGATCTCTATGTTTAGTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-2491s1c1
Sequence:CCGGGCTTAGTGAAAGCTGCAACTTCTCGAGAAGTTGCAGCTTTCACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022070.3-385s1c1
Sequence:CCGGCGGCTATTCATCAGTGTAGTTCTCGAGAACTACACTGATGAATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-2913s1c1
Sequence:CCGGGCCATGAAAGTCCGATGGAATCTCGAGATTCCATCGGACTTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-3316s21c1
Sequence:CCGGATATGGTCCAGTCCTATATTCCTCGAGGAATATAGGACTGGACCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-2881s21c1
Sequence:CCGGAGTCTATCCAGGCCCTAATTTCTCGAGAAATTAGGGCCTGGATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-3653s21c1
Sequence:CCGGGAAACAATCCGTTCACTATTTCTCGAGAAATAGTGAACGGATTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022070.4-602s21c1
Sequence:CCGGTGTGCCAGGACAGCCGTATTTCTCGAGAAATACGGCTGTCCTGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-1664s21c1
Sequence:CCGGTGCACCTTATGATCGTCTAAACTCGAGTTTAGACGATCATAAGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022070
VALIDATED
HEATR6 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-3641s1c1
Sequence:CCGGGCAGAAACAATCCGTTCACTACTCGAGTAGTGAACGGATTGTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-830s1c1
Sequence:CCGGCCCTGGACTAAACATAGAGATCTCGAGATCTCTATGTTTAGTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-2491s1c1
Sequence:CCGGGCTTAGTGAAAGCTGCAACTTCTCGAGAAGTTGCAGCTTTCACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022070.3-385s1c1
Sequence:CCGGCGGCTATTCATCAGTGTAGTTCTCGAGAACTACACTGATGAATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-2913s1c1
Sequence:CCGGGCCATGAAAGTCCGATGGAATCTCGAGATTCCATCGGACTTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-3316s21c1
Sequence:CCGGATATGGTCCAGTCCTATATTCCTCGAGGAATATAGGACTGGACCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-2881s21c1
Sequence:CCGGAGTCTATCCAGGCCCTAATTTCTCGAGAAATTAGGGCCTGGATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-3653s21c1
Sequence:CCGGGAAACAATCCGTTCACTATTTCTCGAGAAATAGTGAACGGATTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022070.4-602s21c1
Sequence:CCGGTGTGCCAGGACAGCCGTATTTCTCGAGAAATACGGCTGTCCTGGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-1664s21c1
Sequence:CCGGTGCACCTTATGATCGTCTAAACTCGAGTTTAGACGATCATAAGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022070
VALIDATED
HEATR6 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-3641s1c1
Sequence:CCGGGCAGAAACAATCCGTTCACTACTCGAGTAGTGAACGGATTGTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-830s1c1
Sequence:CCGGCCCTGGACTAAACATAGAGATCTCGAGATCTCTATGTTTAGTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-2491s1c1
Sequence:CCGGGCTTAGTGAAAGCTGCAACTTCTCGAGAAGTTGCAGCTTTCACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022070.3-385s1c1
Sequence:CCGGCGGCTATTCATCAGTGTAGTTCTCGAGAACTACACTGATGAATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022070.3-2913s1c1
Sequence:CCGGGCCATGAAAGTCCGATGGAATCTCGAGATTCCATCGGACTTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-3316s21c1
Sequence:CCGGATATGGTCCAGTCCTATATTCCTCGAGGAATATAGGACTGGACCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-2881s21c1
Sequence:CCGGAGTCTATCCAGGCCCTAATTTCTCGAGAAATTAGGGCCTGGATAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-3653s21c1
Sequence:CCGGGAAACAATCCGTTCACTATTTCTCGAGAAATAGTGAACGGATTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022070.4-602s21c1
Sequence:CCGGTGTGCCAGGACAGCCGTATTTCTCGAGAAATACGGCTGTCCTGGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022070.4-1664s21c1
Sequence:CCGGTGCACCTTATGATCGTCTAAACTCGAGTTTAGACGATCATAAGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145432
VALIDATED
HEATR6 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-2661s21c1
Sequence:CCGGGACACAGCAAATGCTATATTGCTCGAGCAATATAGCATTTGCTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-1011s21c1
Sequence:CCGGGCTCGATCATCTGCGAATAAACTCGAGTTTATTCGCAGATGATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-899s21c1
Sequence:CCGGTCACGGACTCCCTGGATTAAACTCGAGTTTAATCCAGGGAGTCCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-2632s21c1
Sequence:CCGGGCCTCAGACAGGACGTCATATCTCGAGATATGACGTCCTGTCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-3751s21c1
Sequence:CCGGGAACGGGTTAGTGGCTATTTACTCGAGTAAATAGCCACTAACCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145432
VALIDATED
HEATR6 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-2661s21c1
Sequence:CCGGGACACAGCAAATGCTATATTGCTCGAGCAATATAGCATTTGCTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-1011s21c1
Sequence:CCGGGCTCGATCATCTGCGAATAAACTCGAGTTTATTCGCAGATGATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-899s21c1
Sequence:CCGGTCACGGACTCCCTGGATTAAACTCGAGTTTAATCCAGGGAGTCCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-2632s21c1
Sequence:CCGGGCCTCAGACAGGACGTCATATCTCGAGATATGACGTCCTGTCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-3751s21c1
Sequence:CCGGGAACGGGTTAGTGGCTATTTACTCGAGTAAATAGCCACTAACCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145432
VALIDATED
HEATR6 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-2661s21c1
Sequence:CCGGGACACAGCAAATGCTATATTGCTCGAGCAATATAGCATTTGCTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-1011s21c1
Sequence:CCGGGCTCGATCATCTGCGAATAAACTCGAGTTTATTCGCAGATGATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-899s21c1
Sequence:CCGGTCACGGACTCCCTGGATTAAACTCGAGTTTAATCCAGGGAGTCCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-2632s21c1
Sequence:CCGGGCCTCAGACAGGACGTCATATCTCGAGATATGACGTCCTGTCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145432.3-3751s21c1
Sequence:CCGGGAACGGGTTAGTGGCTATTTACTCGAGTAAATAGCCACTAACCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)