EMAIL THIS PAGE TO A FRIEND

HEBP2

heme binding protein 2

47 Gene Product Result for
Synonyms: C6ORF34B C6orf34 PP23 SOUL
UniProtKB ID: Q9Y5Z4, Q96P57
Gene ID:
Mouse(56016) heme binding protein 2
Rat(308632) heme binding protein 2
domestic guinea pig(100714927) heme binding protein 2
naked mole-rat(101705508) heme binding protein 2
sheep(101114199) heme binding protein 2
Zebrafish(393167) heme binding protein 2
chicken(424441) heme binding protein 2
cow(509223) heme binding protein 2
domestic cat(101084198) heme binding protein 2
dog(484008) heme binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014320 Rosetta Predictions human pricing
NM_001107515 Rosetta Predictions rat pricing
NM_019487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345425 predicted 655
2 SASI_Hs01_00217292 predicted 589
3 SASI_Hs01_00217294 predicted 568
4 SASI_Hs01_00217295 predicted 474
5 SASI_Hs01_00217296 predicted 659
6 SASI_Hs01_00217297 predicted 452
7 SASI_Hs01_00217298 predicted 597
8 SASI_Hs01_00217299 predicted 615
9 SASI_Hs01_00217300 predicted 569
10 SASI_Hs01_00217301 predicted 476
11 SASI_Hs01_00217293 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229585 predicted 1040
2 SASI_Rn02_00229586 predicted 1008
3 SASI_Rn02_00229587 predicted 408
4 SASI_Rn02_00229588 predicted 607
5 SASI_Rn02_00229589 predicted 769
6 SASI_Rn02_00229590 predicted 700
7 SASI_Rn02_00229591 predicted 1197
8 SASI_Rn02_00229592 predicted 1037
9 SASI_Rn02_00229593 predicted 1200
10 SASI_Rn02_00229594 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324506 predicted 947
2 SASI_Mm01_00090740 predicted 383
3 SASI_Mm01_00090741 predicted 994
4 SASI_Mm01_00090742 predicted 584
5 SASI_Mm01_00090743 predicted 351
6 SASI_Mm01_00090744 predicted 389
7 SASI_Mm01_00090745 predicted 648
8 SASI_Mm01_00090747 predicted 587
9 SASI_Mm01_00090748 predicted 891
10 SASI_Mm02_00324507 predicted 941
11 SASI_Mm01_00090739 predicted 761
12 SASI_Mm01_00090746 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014320
VALIDATED
HEBP2 MISSION shRNA Bacterial Glycerol Stock
heme binding protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014320.2-1036s21c1
Sequence:CCGGGCTTATTTCCAATGTGCCTTTCTCGAGAAAGGCACATTGGAAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-491s1c1
Sequence:CCGGGCTTTACGAAACTGAACAGCTCTCGAGAGCTGTTCAGTTTCGTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-608s1c1
Sequence:CCGGCCATTACCATTTCCCTGTATACTCGAGTATACAGGGAAATGGTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-1036s1c1
Sequence:CCGGGCTTATTTCCAATGTGCCTTTCTCGAGAAAGGCACATTGGAAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-994s1c1
Sequence:CCGGGCGTGTCTAGTGTCTTCTATTCTCGAGAATAGAAGACACTAGACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-694s1c1
Sequence:CCGGGCCGAAATGACTGTGTTTGTACTCGAGTACAAACACAGTCATTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014320.2-407s21c1
Sequence:CCGGGTTATGAGATCCGACACTATGCTCGAGCATAGTGTCGGATCTCATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014320.2-994s21c1
Sequence:CCGGGCGTGTCTAGTGTCTTCTATTCTCGAGAATAGAAGACACTAGACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-808s1c1
Sequence:CCGGGAGAAGGTTTACTACACTGCACTCGAGTGCAGTGTAGTAAACCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-1083s1c1
Sequence:CCGGCACAGGTAACAGAGGACAGTACTCGAGTACTGTCCTCTGTTACCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014320.2-694s21c1
Sequence:CCGGGCCGAAATGACTGTGTTTGTACTCGAGTACAAACACAGTCATTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014320
VALIDATED
HEBP2 MISSION shRNA shRNA Plasmid DNA
heme binding protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014320.2-1036s21c1
Sequence:CCGGGCTTATTTCCAATGTGCCTTTCTCGAGAAAGGCACATTGGAAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-491s1c1
Sequence:CCGGGCTTTACGAAACTGAACAGCTCTCGAGAGCTGTTCAGTTTCGTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-608s1c1
Sequence:CCGGCCATTACCATTTCCCTGTATACTCGAGTATACAGGGAAATGGTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-1036s1c1
Sequence:CCGGGCTTATTTCCAATGTGCCTTTCTCGAGAAAGGCACATTGGAAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-994s1c1
Sequence:CCGGGCGTGTCTAGTGTCTTCTATTCTCGAGAATAGAAGACACTAGACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-694s1c1
Sequence:CCGGGCCGAAATGACTGTGTTTGTACTCGAGTACAAACACAGTCATTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014320.2-407s21c1
Sequence:CCGGGTTATGAGATCCGACACTATGCTCGAGCATAGTGTCGGATCTCATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014320.2-994s21c1
Sequence:CCGGGCGTGTCTAGTGTCTTCTATTCTCGAGAATAGAAGACACTAGACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-808s1c1
Sequence:CCGGGAGAAGGTTTACTACACTGCACTCGAGTGCAGTGTAGTAAACCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-1083s1c1
Sequence:CCGGCACAGGTAACAGAGGACAGTACTCGAGTACTGTCCTCTGTTACCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014320.2-694s21c1
Sequence:CCGGGCCGAAATGACTGTGTTTGTACTCGAGTACAAACACAGTCATTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014320
VALIDATED
HEBP2 MISSION shRNA Lentiviral Transduction Particles
heme binding protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014320.2-1036s21c1
Sequence:CCGGGCTTATTTCCAATGTGCCTTTCTCGAGAAAGGCACATTGGAAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-491s1c1
Sequence:CCGGGCTTTACGAAACTGAACAGCTCTCGAGAGCTGTTCAGTTTCGTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-608s1c1
Sequence:CCGGCCATTACCATTTCCCTGTATACTCGAGTATACAGGGAAATGGTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-1036s1c1
Sequence:CCGGGCTTATTTCCAATGTGCCTTTCTCGAGAAAGGCACATTGGAAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-994s1c1
Sequence:CCGGGCGTGTCTAGTGTCTTCTATTCTCGAGAATAGAAGACACTAGACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-694s1c1
Sequence:CCGGGCCGAAATGACTGTGTTTGTACTCGAGTACAAACACAGTCATTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014320.2-407s21c1
Sequence:CCGGGTTATGAGATCCGACACTATGCTCGAGCATAGTGTCGGATCTCATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014320.2-994s21c1
Sequence:CCGGGCGTGTCTAGTGTCTTCTATTCTCGAGAATAGAAGACACTAGACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014320.2-808s1c1
Sequence:CCGGGAGAAGGTTTACTACACTGCACTCGAGTGCAGTGTAGTAAACCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014320.2-1083s1c1
Sequence:CCGGCACAGGTAACAGAGGACAGTACTCGAGTACTGTCCTCTGTTACCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014320.2-694s21c1
Sequence:CCGGGCCGAAATGACTGTGTTTGTACTCGAGTACAAACACAGTCATTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019487
VALIDATED
HEBP2 MISSION shRNA Bacterial Glycerol Stock
heme binding protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-952s21c1
Sequence:CCGGGAGCACTCATAGGCGACATATCTCGAGATATGTCGCCTATGAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-847s21c1
Sequence:CCGGATAACGAAGTGTGGCTGATTCCTCGAGGAATCAGCCACACTTCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019487.3-837s1c1
Sequence:CCGGCTTGATAGAAATAACGAAGTGCTCGAGCACTTCGTTATTTCTATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019487.2-1337s1c1
Sequence:CCGGCCCTGAACAAAGACAGTTCTTCTCGAGAAGAACTGTCTTTGTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019487.2-571s1c1
Sequence:CCGGCAAGTCCTTTCAGTGAGTCTACTCGAGTAGACTCACTGAAAGGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019487.2-1203s1c1
Sequence:CCGGCCTTCCTTAATAACACTGAAACTCGAGTTTCAGTGTTATTAAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-879s21c1
Sequence:CCGGCCCTCCGTCGAGAACAAATAACTCGAGTTATTTGTTCTCGACGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-583s21c1
Sequence:CCGGGTGAGTCTACCATTACGATTTCTCGAGAAATCGTAATGGTAGACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-819s21c1
Sequence:CCGGAGCAGTCCTTTCCAATTACTTCTCGAGAAGTAATTGGAAAGGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019487
VALIDATED
HEBP2 MISSION shRNA shRNA Plasmid DNA
heme binding protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-952s21c1
Sequence:CCGGGAGCACTCATAGGCGACATATCTCGAGATATGTCGCCTATGAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-847s21c1
Sequence:CCGGATAACGAAGTGTGGCTGATTCCTCGAGGAATCAGCCACACTTCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019487.3-837s1c1
Sequence:CCGGCTTGATAGAAATAACGAAGTGCTCGAGCACTTCGTTATTTCTATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019487.2-1337s1c1
Sequence:CCGGCCCTGAACAAAGACAGTTCTTCTCGAGAAGAACTGTCTTTGTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019487.2-571s1c1
Sequence:CCGGCAAGTCCTTTCAGTGAGTCTACTCGAGTAGACTCACTGAAAGGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019487.2-1203s1c1
Sequence:CCGGCCTTCCTTAATAACACTGAAACTCGAGTTTCAGTGTTATTAAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-879s21c1
Sequence:CCGGCCCTCCGTCGAGAACAAATAACTCGAGTTATTTGTTCTCGACGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-583s21c1
Sequence:CCGGGTGAGTCTACCATTACGATTTCTCGAGAAATCGTAATGGTAGACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-819s21c1
Sequence:CCGGAGCAGTCCTTTCCAATTACTTCTCGAGAAGTAATTGGAAAGGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019487
VALIDATED
HEBP2 MISSION shRNA Lentiviral Transduction Particles
heme binding protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-952s21c1
Sequence:CCGGGAGCACTCATAGGCGACATATCTCGAGATATGTCGCCTATGAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-847s21c1
Sequence:CCGGATAACGAAGTGTGGCTGATTCCTCGAGGAATCAGCCACACTTCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019487.3-837s1c1
Sequence:CCGGCTTGATAGAAATAACGAAGTGCTCGAGCACTTCGTTATTTCTATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019487.2-1337s1c1
Sequence:CCGGCCCTGAACAAAGACAGTTCTTCTCGAGAAGAACTGTCTTTGTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019487.2-571s1c1
Sequence:CCGGCAAGTCCTTTCAGTGAGTCTACTCGAGTAGACTCACTGAAAGGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019487.2-1203s1c1
Sequence:CCGGCCTTCCTTAATAACACTGAAACTCGAGTTTCAGTGTTATTAAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-879s21c1
Sequence:CCGGCCCTCCGTCGAGAACAAATAACTCGAGTTATTTGTTCTCGACGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-583s21c1
Sequence:CCGGGTGAGTCTACCATTACGATTTCTCGAGAAATCGTAATGGTAGACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019487.3-819s21c1
Sequence:CCGGAGCAGTCCTTTCCAATTACTTCTCGAGAAGTAATTGGAAAGGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)