EMAIL THIS PAGE TO A FRIEND

HECTD1

HECT domain containing E3 ubiquitin protein ligase 1

133 Gene Product Result for
UniProtKB ID: Q9ULT8, D3DS86, Q6P445, Q86VJ1, Q96F34, Q9UFZ7
Gene ID:
Mouse(207304) HECT domain containing 1
Rat(362736) HECT domain containing E3 ubiquitin protein ligase 1
Zebrafish(100002034) HECT domain containing 1
chicken(423310) HECT domain containing E3 ubiquitin protein ligase 1
domestic cat(101086980) HECT domain containing E3 ubiquitin protein ligase 1
cow(536240) HECT domain containing E3 ubiquitin protein ligase 1
Horse(100050203) HECT domain containing E3 ubiquitin protein ligase 1
dog(480284) HECT domain containing E3 ubiquitin protein ligase 1
domestic guinea pig(100733097) HECT domain containing E3 ubiquitin protein ligase 1
naked mole-rat(101699905) HECT domain containing E3 ubiquitin protein ligase 1
sheep(100135435) HECT domain containing E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015382 siRNAs that have been validated in the lab human pricing
XM_001078686 Rosetta Predictions rat pricing
XM_343060 Rosetta Predictions rat pricing
XM_915167 Rosetta Predictions mouse pricing
XM_974905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015382 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000070 validated 4116
1 SASI_WI_00000072 validated 791
1 SASI_WI_00000071 validated 9004
2 SASI_Hs01_00141001 predicted 5151
3 SASI_Hs01_00141003 predicted 4876
4 SASI_Hs01_00141004 predicted 8003
5 SASI_Hs02_00347735 predicted 1824
6 SASI_Hs01_00141005 predicted 2735
7 SASI_Hs01_00141006 predicted 1019
8 SASI_Hs01_00141007 predicted 3770
9 SASI_Hs01_00141008 predicted 4444
10 SASI_Hs01_00141009 predicted 7579
11 SASI_Hs01_00141010 predicted 8099
12 SASI_Hs01_00141002 predicted 3107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361707 predicted 915
2 SASI_Rn02_00361708 predicted 5448
3 SASI_Rn02_00361709 predicted 2204
4 SASI_Rn02_00361710 predicted 2588
5 SASI_Rn02_00361711 predicted 7128
6 SASI_Rn02_00361712 predicted 5218
7 SASI_Rn02_00361713 predicted 5058
8 SASI_Rn02_00361714 predicted 3570
9 SASI_Rn02_00361715 predicted 6714
10 SASI_Rn02_00361716 predicted 6792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395241 predicted 6196
2 SASI_Rn02_00395242 predicted 2470
3 SASI_Rn02_00395243 predicted 2855
4 SASI_Rn02_00395244 predicted 7885
5 SASI_Rn02_00395245 predicted 5972
6 SASI_Rn02_00395246 predicted 5806
7 SASI_Rn02_00395247 predicted 3640
8 SASI_Rn02_00395248 predicted 4324
9 SASI_Rn02_00395249 predicted 7461
10 SASI_Rn02_00395250 predicted 7532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439228 predicted 5823
2 SASI_Mm02_00439229 predicted 5216
3 SASI_Mm02_00439230 predicted 2353
4 SASI_Mm02_00439231 predicted 3504
5 SASI_Mm02_00439232 predicted 2613
6 SASI_Mm02_00439233 predicted 4197
7 SASI_Mm02_00439234 predicted 2744
8 SASI_Mm02_00439235 predicted 1053
9 SASI_Mm02_00439236 predicted 3033
10 SASI_Mm02_00439237 predicted 2961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225815 predicted 5820
2 SASI_Mm01_00225816 predicted 5213
3 SASI_Mm01_00225819 predicted 2347
4 SASI_Mm02_00445456 predicted 3501
5 SASI_Mm01_00225821 predicted 2612
6 SASI_Mm01_00225822 predicted 4196
7 SASI_Mm01_00225823 predicted 2732
8 SASI_Mm01_00225824 predicted 1049
9 SASI_Mm02_00445457 predicted 3030
10 SASI_Mm02_00445458 predicted 2957
11 SASI_Mm01_00225817 predicted 764
12 SASI_Mm01_00225818 predicted 5729
13 SASI_Mm01_00225820 predicted 4470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015382
VALIDATED
HECTD1 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-475s1c1
Sequence:CCGGGCACTTTCTTACCAGCCCTTTCTCGAGAAAGGGCTGGTAAGAAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-4723s1c1
Sequence:CCGGGCCCTGATAGTTCTGTTCGTACTCGAGTACGAACAGAACTATCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015382.x-5007s1c1
Sequence:CCGGGCCACGAACAACATGAATCTACTCGAGTAGATTCATGTTGTTCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-8674s1c1
Sequence:CCGGTCTCTCTTTGTTTGGCATATACTCGAGTATATGCCAAACAAAGAGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015382.x-2835s1c1
Sequence:CCGGCGAGATTTATACGATGACCATCTCGAGATGGTCATCGTATAAATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-1670s21c1
Sequence:CCGGATGTAGGTCAGACTCTATTAACTCGAGTTAATAGAGTCTGACCTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-3363s21c1
Sequence:CCGGTCGACCAGCAGTTGCGTTAATCTCGAGATTAACGCAACTGCTGGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-7588s21c1
Sequence:CCGGGCTATCAAGAGGCGCCAAATTCTCGAGAATTTGGCGCCTCTTGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-7700s21c1
Sequence:CCGGGCATAGAGGATTTAGGTTTAACTCGAGTTAAACCTAAATCCTCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015382
VALIDATED
HECTD1 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-475s1c1
Sequence:CCGGGCACTTTCTTACCAGCCCTTTCTCGAGAAAGGGCTGGTAAGAAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-4723s1c1
Sequence:CCGGGCCCTGATAGTTCTGTTCGTACTCGAGTACGAACAGAACTATCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015382.x-5007s1c1
Sequence:CCGGGCCACGAACAACATGAATCTACTCGAGTAGATTCATGTTGTTCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-8674s1c1
Sequence:CCGGTCTCTCTTTGTTTGGCATATACTCGAGTATATGCCAAACAAAGAGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015382.x-2835s1c1
Sequence:CCGGCGAGATTTATACGATGACCATCTCGAGATGGTCATCGTATAAATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-1670s21c1
Sequence:CCGGATGTAGGTCAGACTCTATTAACTCGAGTTAATAGAGTCTGACCTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-3363s21c1
Sequence:CCGGTCGACCAGCAGTTGCGTTAATCTCGAGATTAACGCAACTGCTGGTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-7588s21c1
Sequence:CCGGGCTATCAAGAGGCGCCAAATTCTCGAGAATTTGGCGCCTCTTGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-7700s21c1
Sequence:CCGGGCATAGAGGATTTAGGTTTAACTCGAGTTAAACCTAAATCCTCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015382
VALIDATED
HECTD1 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-475s1c1
Sequence:CCGGGCACTTTCTTACCAGCCCTTTCTCGAGAAAGGGCTGGTAAGAAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-4723s1c1
Sequence:CCGGGCCCTGATAGTTCTGTTCGTACTCGAGTACGAACAGAACTATCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015382.x-5007s1c1
Sequence:CCGGGCCACGAACAACATGAATCTACTCGAGTAGATTCATGTTGTTCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015382.x-8674s1c1
Sequence:CCGGTCTCTCTTTGTTTGGCATATACTCGAGTATATGCCAAACAAAGAGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015382.x-2835s1c1
Sequence:CCGGCGAGATTTATACGATGACCATCTCGAGATGGTCATCGTATAAATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-1670s21c1
Sequence:CCGGATGTAGGTCAGACTCTATTAACTCGAGTTAATAGAGTCTGACCTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-3363s21c1
Sequence:CCGGTCGACCAGCAGTTGCGTTAATCTCGAGATTAACGCAACTGCTGGTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-7588s21c1
Sequence:CCGGGCTATCAAGAGGCGCCAAATTCTCGAGAATTTGGCGCCTCTTGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015382.2-7700s21c1
Sequence:CCGGGCATAGAGGATTTAGGTTTAACTCGAGTTAAACCTAAATCCTCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144788
VALIDATED
HECTD1 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-7467s21c1
Sequence:CCGGCGCCAGATTCTAGGCAATAAACTCGAGTTTATTGCCTAGAATCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-3613s21c1
Sequence:CCGGCTGCGTATGAATGGGTAAATCCTCGAGGATTTACCCATTCATACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-8301s21c1
Sequence:CCGGCTTCGAGAACACGTGGAATAACTCGAGTTATTCCACGTGTTCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144788.2-1173s21c1
Sequence:CCGGAGTAACCAGGTGTCGACAATTCTCGAGAATTGTCGACACCTGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-6060s21c1
Sequence:CCGGTACCTTGGCACTGACGAATTACTCGAGTAATTCGTCAGTGCCAAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144788
VALIDATED
HECTD1 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-7467s21c1
Sequence:CCGGCGCCAGATTCTAGGCAATAAACTCGAGTTTATTGCCTAGAATCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-3613s21c1
Sequence:CCGGCTGCGTATGAATGGGTAAATCCTCGAGGATTTACCCATTCATACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-8301s21c1
Sequence:CCGGCTTCGAGAACACGTGGAATAACTCGAGTTATTCCACGTGTTCTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144788.2-1173s21c1
Sequence:CCGGAGTAACCAGGTGTCGACAATTCTCGAGAATTGTCGACACCTGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-6060s21c1
Sequence:CCGGTACCTTGGCACTGACGAATTACTCGAGTAATTCGTCAGTGCCAAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144788
VALIDATED
HECTD1 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-7467s21c1
Sequence:CCGGCGCCAGATTCTAGGCAATAAACTCGAGTTTATTGCCTAGAATCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-3613s21c1
Sequence:CCGGCTGCGTATGAATGGGTAAATCCTCGAGGATTTACCCATTCATACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-8301s21c1
Sequence:CCGGCTTCGAGAACACGTGGAATAACTCGAGTTATTCCACGTGTTCTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144788.2-1173s21c1
Sequence:CCGGAGTAACCAGGTGTCGACAATTCTCGAGAATTGTCGACACCTGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144788.2-6060s21c1
Sequence:CCGGTACCTTGGCACTGACGAATTACTCGAGTAATTCGTCAGTGCCAAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)