EMAIL THIS PAGE TO A FRIEND

HECTD2

HECT domain containing E3 ubiquitin protein ligase 2

222 Gene Product Result for
UniProtKB ID: Q5U5R9, Q5VZ97, Q5VZ98, Q5VZ99, Q8N1X7, Q8TCP5
Gene ID:
Mouse(226098) HECT domain containing 2
Rat(309514) HECT domain containing E3 ubiquitin protein ligase 2
sheep(101103687) HECT domain containing E3 ubiquitin protein ligase 2
domestic guinea pig(100713517) HECT domain containing E3 ubiquitin protein ligase 2
Zebrafish(562999) HECT domain containing 2
chicken(427031) HECT domain containing E3 ubiquitin protein ligase 2
cow(520752) HECT domain containing E3 ubiquitin protein ligase 2
Horse(100071434) HECT domain containing E3 ubiquitin protein ligase 2
domestic cat(101092645) HECT domain containing E3 ubiquitin protein ligase 2
dog(486795) HECT domain containing E3 ubiquitin protein ligase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066571 MISSION® esiRNA esiRNA human HECTD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173497 Rosetta Predictions human pricing
NM_182765 Rosetta Predictions human pricing
NM_001107608 Rosetta Predictions rat pricing
NM_172637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239422 predicted 412
2 SASI_Hs01_00239423 predicted 615
3 SASI_Hs01_00239424 predicted 366
4 SASI_Hs01_00239425 predicted 404
5 SASI_Hs01_00239426 predicted 556
6 SASI_Hs01_00239427 predicted 529
7 SASI_Hs01_00239428 predicted 408
8 SASI_Hs01_00239429 predicted 366
9 SASI_Hs01_00239430 predicted 414
10 SASI_Hs01_00239431 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067225 predicted 414
2 SASI_Hs01_00067226 predicted 1818
3 SASI_Hs02_00370930 predicted 1694
4 SASI_Hs01_00067229 predicted 1804
5 SASI_Hs01_00067230 predicted 1450
6 SASI_Hs02_00370931 predicted 822
7 SASI_Hs01_00067231 predicted 1957
8 SASI_Hs02_00370932 predicted 551
9 SASI_Hs01_00067232 predicted 370
10 SASI_Hs02_00370933 predicted 659
11 SASI_Hs01_00067227 predicted 2380
12 SASI_Hs01_00067228 predicted 2475
13 SASI_Hs01_00067233 predicted 654
14 SASI_Hs01_00067234 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230515 predicted 655
2 SASI_Rn02_00230516 predicted 406
3 SASI_Rn02_00230517 predicted 499
4 SASI_Rn02_00230518 predicted 680
5 SASI_Rn02_00230519 predicted 342
6 SASI_Rn02_00230520 predicted 675
7 SASI_Rn02_00230521 predicted 489
8 SASI_Rn02_00230522 predicted 514
9 SASI_Rn02_00230523 predicted 571
10 SASI_Rn02_00230524 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138269 predicted 277
2 SASI_Mm02_00344343 predicted 552
3 SASI_Mm01_00138271 predicted 851
4 SASI_Mm01_00138272 predicted 1640
5 SASI_Mm01_00138273 predicted 1966
6 SASI_Mm01_00138274 predicted 483
7 SASI_Mm01_00138275 predicted 1358
8 SASI_Mm01_00138276 predicted 732
9 SASI_Mm01_00138277 predicted 1915
10 SASI_Mm01_00138278 predicted 311
11 SASI_Mm01_00138270 predicted 1837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173497
VALIDATED
HECTD2 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-523s21c1
Sequence:CCGGAGTTAAGTCATCAGGAGATTGCTCGAGCAATCTCCTGATGACTTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-705s21c1
Sequence:CCGGGTATTATGACATGCAAGTAATCTCGAGATTACTTGCATGTCATAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-453s21c1
Sequence:CCGGCAGTCCTTCCAGAACCTATTCCTCGAGGAATAGGTTCTGGAAGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1203s21c1
Sequence:CCGGATGCATATTTGAAGGACTAAGCTCGAGCTTAGTCCTTCAAATATGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-562s21c1
Sequence:CCGGTTATCTAACAACGTTTGATTCCTCGAGGAATCAAACGTTGTTAGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-382s21c1
Sequence:CCGGACCAATTTGCCTTGATGTTAGCTCGAGCTAACATCAAGGCAAATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-425s21c1
Sequence:CCGGGATGCATCATCATCCGAAATGCTCGAGCATTTCGGATGATGATGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1001s21c1
Sequence:CCGGTGTAGATCAGTGGTTCTTAAACTCGAGTTTAAGAACCACTGATCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1217s21c1
Sequence:CCGGGACTAAGTGGGAATGATAAAGCTCGAGCTTTATCATTCCCACTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-636s21c1
Sequence:CCGGCCATTGAAGACTCTGGGATTACTCGAGTAATCCCAGAGTCTTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173497.1-789s1c1
Sequence:CCGGCCTTAGAAACTCTGATACAATCTCGAGATTGTATCAGAGTTTCTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-581s1c1
Sequence:CCGGCCCAGAATTAAATGCTGCATTCTCGAGAATGCAGCATTTAATTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-298s1c1
Sequence:CCGGCGAAGAAAGAAGCTGCTGAAACTCGAGTTTCAGCAGCTTCTTTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-618s1c1
Sequence:CCGGGCCTCATTTAACACCATTGAACTCGAGTTCAATGGTGTTAAATGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_173497.1-669s1c1
Sequence:CCGGGCTGTGTATGATACCTTACTTCTCGAGAAGTAAGGTATCATACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173497
VALIDATED
HECTD2 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-523s21c1
Sequence:CCGGAGTTAAGTCATCAGGAGATTGCTCGAGCAATCTCCTGATGACTTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-705s21c1
Sequence:CCGGGTATTATGACATGCAAGTAATCTCGAGATTACTTGCATGTCATAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-453s21c1
Sequence:CCGGCAGTCCTTCCAGAACCTATTCCTCGAGGAATAGGTTCTGGAAGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1203s21c1
Sequence:CCGGATGCATATTTGAAGGACTAAGCTCGAGCTTAGTCCTTCAAATATGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-562s21c1
Sequence:CCGGTTATCTAACAACGTTTGATTCCTCGAGGAATCAAACGTTGTTAGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-382s21c1
Sequence:CCGGACCAATTTGCCTTGATGTTAGCTCGAGCTAACATCAAGGCAAATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-425s21c1
Sequence:CCGGGATGCATCATCATCCGAAATGCTCGAGCATTTCGGATGATGATGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1001s21c1
Sequence:CCGGTGTAGATCAGTGGTTCTTAAACTCGAGTTTAAGAACCACTGATCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1217s21c1
Sequence:CCGGGACTAAGTGGGAATGATAAAGCTCGAGCTTTATCATTCCCACTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-636s21c1
Sequence:CCGGCCATTGAAGACTCTGGGATTACTCGAGTAATCCCAGAGTCTTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173497.1-789s1c1
Sequence:CCGGCCTTAGAAACTCTGATACAATCTCGAGATTGTATCAGAGTTTCTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-581s1c1
Sequence:CCGGCCCAGAATTAAATGCTGCATTCTCGAGAATGCAGCATTTAATTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-298s1c1
Sequence:CCGGCGAAGAAAGAAGCTGCTGAAACTCGAGTTTCAGCAGCTTCTTTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-618s1c1
Sequence:CCGGGCCTCATTTAACACCATTGAACTCGAGTTCAATGGTGTTAAATGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_173497.1-669s1c1
Sequence:CCGGGCTGTGTATGATACCTTACTTCTCGAGAAGTAAGGTATCATACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173497
VALIDATED
HECTD2 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-523s21c1
Sequence:CCGGAGTTAAGTCATCAGGAGATTGCTCGAGCAATCTCCTGATGACTTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-705s21c1
Sequence:CCGGGTATTATGACATGCAAGTAATCTCGAGATTACTTGCATGTCATAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-453s21c1
Sequence:CCGGCAGTCCTTCCAGAACCTATTCCTCGAGGAATAGGTTCTGGAAGGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1203s21c1
Sequence:CCGGATGCATATTTGAAGGACTAAGCTCGAGCTTAGTCCTTCAAATATGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-562s21c1
Sequence:CCGGTTATCTAACAACGTTTGATTCCTCGAGGAATCAAACGTTGTTAGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-382s21c1
Sequence:CCGGACCAATTTGCCTTGATGTTAGCTCGAGCTAACATCAAGGCAAATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-425s21c1
Sequence:CCGGGATGCATCATCATCCGAAATGCTCGAGCATTTCGGATGATGATGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1001s21c1
Sequence:CCGGTGTAGATCAGTGGTTCTTAAACTCGAGTTTAAGAACCACTGATCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173497.2-1217s21c1
Sequence:CCGGGACTAAGTGGGAATGATAAAGCTCGAGCTTTATCATTCCCACTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173497.2-636s21c1
Sequence:CCGGCCATTGAAGACTCTGGGATTACTCGAGTAATCCCAGAGTCTTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173497.1-789s1c1
Sequence:CCGGCCTTAGAAACTCTGATACAATCTCGAGATTGTATCAGAGTTTCTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-581s1c1
Sequence:CCGGCCCAGAATTAAATGCTGCATTCTCGAGAATGCAGCATTTAATTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-298s1c1
Sequence:CCGGCGAAGAAAGAAGCTGCTGAAACTCGAGTTTCAGCAGCTTCTTTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173497.1-618s1c1
Sequence:CCGGGCCTCATTTAACACCATTGAACTCGAGTTCAATGGTGTTAAATGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_173497.1-669s1c1
Sequence:CCGGGCTGTGTATGATACCTTACTTCTCGAGAAGTAAGGTATCATACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172637
HECTD2 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-1245s21c1
Sequence:CCGGGTCAGTACCCATTCGTTATTTCTCGAGAAATAACGAATGGGTACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-759s21c1
Sequence:CCGGCAGTATTGAAGGGAATCATTACTCGAGTAATGATTCCCTTCAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-1913s21c1
Sequence:CCGGGGAGTAATTAAATCCTATAACCTCGAGGTTATAGGATTTAATTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172637.3-2627s21c1
Sequence:CCGGTATAGTGAAGGCATGATTTAACTCGAGTTAAATCATGCCTTCACTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172637.1-3644s1c1
Sequence:CCGGCCAGCATTTAGTACCAGCTTACTCGAGTAAGCTGGTACTAAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-1282s1c1
Sequence:CCGGGCGACTCACTTGATGAGTTAACTCGAGTTAACTCATCAAGTGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-642s1c1
Sequence:CCGGAGCTTGTTACAAGAATGGAAACTCGAGTTTCCATTCTTGTAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-786s1c1
Sequence:CCGGGCTGACCATCACTTCCTAGTTCTCGAGAACTAGGAAGTGATGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-997s1c1
Sequence:CCGGCCCTCGTTCCTTACACTGATTCTCGAGAATCAGTGTAAGGAACGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172637
HECTD2 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-1245s21c1
Sequence:CCGGGTCAGTACCCATTCGTTATTTCTCGAGAAATAACGAATGGGTACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-759s21c1
Sequence:CCGGCAGTATTGAAGGGAATCATTACTCGAGTAATGATTCCCTTCAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-1913s21c1
Sequence:CCGGGGAGTAATTAAATCCTATAACCTCGAGGTTATAGGATTTAATTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172637.3-2627s21c1
Sequence:CCGGTATAGTGAAGGCATGATTTAACTCGAGTTAAATCATGCCTTCACTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172637.1-3644s1c1
Sequence:CCGGCCAGCATTTAGTACCAGCTTACTCGAGTAAGCTGGTACTAAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-1282s1c1
Sequence:CCGGGCGACTCACTTGATGAGTTAACTCGAGTTAACTCATCAAGTGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-642s1c1
Sequence:CCGGAGCTTGTTACAAGAATGGAAACTCGAGTTTCCATTCTTGTAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-786s1c1
Sequence:CCGGGCTGACCATCACTTCCTAGTTCTCGAGAACTAGGAAGTGATGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-997s1c1
Sequence:CCGGCCCTCGTTCCTTACACTGATTCTCGAGAATCAGTGTAAGGAACGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172637
HECTD2 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-1245s21c1
Sequence:CCGGGTCAGTACCCATTCGTTATTTCTCGAGAAATAACGAATGGGTACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-759s21c1
Sequence:CCGGCAGTATTGAAGGGAATCATTACTCGAGTAATGATTCCCTTCAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172637.3-1913s21c1
Sequence:CCGGGGAGTAATTAAATCCTATAACCTCGAGGTTATAGGATTTAATTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172637.3-2627s21c1
Sequence:CCGGTATAGTGAAGGCATGATTTAACTCGAGTTAAATCATGCCTTCACTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172637.1-3644s1c1
Sequence:CCGGCCAGCATTTAGTACCAGCTTACTCGAGTAAGCTGGTACTAAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-1282s1c1
Sequence:CCGGGCGACTCACTTGATGAGTTAACTCGAGTTAACTCATCAAGTGAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-642s1c1
Sequence:CCGGAGCTTGTTACAAGAATGGAAACTCGAGTTTCCATTCTTGTAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-786s1c1
Sequence:CCGGGCTGACCATCACTTCCTAGTTCTCGAGAACTAGGAAGTGATGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172637.1-997s1c1
Sequence:CCGGCCCTCGTTCCTTACACTGATTCTCGAGAATCAGTGTAAGGAACGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)