EMAIL THIS PAGE TO A FRIEND

HECTD3

HECT domain containing E3 ubiquitin protein ligase 3

65 Gene Product Result for
Synonyms: RP11-69J16.1
UniProtKB ID: Q5T447, B3KPV7, B3KRH4, Q5T448, Q9H783
Gene ID:
Human(79654) Summary: The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Mouse(76608) HECT domain containing 3
Zebrafish(563189) HECT domain containing 3
dog(482518) HECT domain containing E3 ubiquitin protein ligase 3
cow(513646) HECT domain containing 3
domestic cat(101101399) HECT domain containing E3 ubiquitin protein ligase 3
chicken(424589) HECT domain containing 3
domestic guinea pig(100723587) HECT domain containing E3 ubiquitin protein ligase 3
naked mole-rat(101705554) HECT domain containing E3 ubiquitin protein ligase 3
sheep(101110558) HECT domain containing E3 ubiquitin protein ligase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371246 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024602 Rosetta Predictions human pricing
NM_175244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176810 predicted 2513
2 SASI_Hs02_00356956 predicted 701
3 SASI_Hs01_00176811 predicted 1251
4 SASI_Hs01_00176812 predicted 1866
5 SASI_Hs01_00176813 predicted 1216
6 SASI_Hs02_00356957 predicted 1206
7 SASI_Hs01_00176815 predicted 1268
8 SASI_Hs01_00176816 predicted 1578
9 SASI_Hs01_00176817 predicted 2763
10 SASI_Hs01_00176818 predicted 1128
11 SASI_Hs01_00176814 predicted 1010
12 SASI_Hs01_00176819 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074199 predicted 1563
2 SASI_Mm01_00074200 predicted 1824
3 SASI_Mm01_00074201 predicted 648
4 SASI_Mm01_00074202 predicted 790
5 SASI_Mm01_00074203 predicted 952
6 SASI_Mm01_00074204 predicted 2447
7 SASI_Mm01_00074205 predicted 782
8 SASI_Mm01_00074206 predicted 652
9 SASI_Mm01_00074207 predicted 2379
10 SASI_Mm01_00074208 predicted 2541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024602
HECTD3 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-1587s21c1
Sequence:CCGGGCAGTCTTCACCCAGGTATATCTCGAGATATACCTGGGTGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-595s21c1
Sequence:CCGGAGCTCTTTGGCGTGGATTATCCTCGAGGATAATCCACGCCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-1872s21c1
Sequence:CCGGTGCCGAGACTTTGCCAAGTATCTCGAGATACTTGGCAAAGTCTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-2042s21c1
Sequence:CCGGCCTGGAAGTGATGGAAGGAATCTCGAGATTCCTTCCATCACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024602.5-2835s21c1
Sequence:CCGGTGGCATGGTCAGGTAACACTACTCGAGTAGTGTTACCTGACCATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024602
HECTD3 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-1587s21c1
Sequence:CCGGGCAGTCTTCACCCAGGTATATCTCGAGATATACCTGGGTGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-595s21c1
Sequence:CCGGAGCTCTTTGGCGTGGATTATCCTCGAGGATAATCCACGCCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-1872s21c1
Sequence:CCGGTGCCGAGACTTTGCCAAGTATCTCGAGATACTTGGCAAAGTCTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-2042s21c1
Sequence:CCGGCCTGGAAGTGATGGAAGGAATCTCGAGATTCCTTCCATCACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024602.5-2835s21c1
Sequence:CCGGTGGCATGGTCAGGTAACACTACTCGAGTAGTGTTACCTGACCATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024602
HECTD3 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-1587s21c1
Sequence:CCGGGCAGTCTTCACCCAGGTATATCTCGAGATATACCTGGGTGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-595s21c1
Sequence:CCGGAGCTCTTTGGCGTGGATTATCCTCGAGGATAATCCACGCCAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-1872s21c1
Sequence:CCGGTGCCGAGACTTTGCCAAGTATCTCGAGATACTTGGCAAAGTCTCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024602.5-2042s21c1
Sequence:CCGGCCTGGAAGTGATGGAAGGAATCTCGAGATTCCTTCCATCACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024602.5-2835s21c1
Sequence:CCGGTGGCATGGTCAGGTAACACTACTCGAGTAGTGTTACCTGACCATGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175244
VALIDATED
HECTD3 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1576s21c1
Sequence:CCGGGCCTTCTGACAAGTATGAGAACTCGAGTTCTCATACTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1083s21c1
Sequence:CCGGCCGTCCACCTTCCAATCATTGCTCGAGCAATGATTGGAAGGTGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-2829s21c1
Sequence:CCGGGCTTGCTTCCCTAGGTATTTACTCGAGTAAATACCTAGGGAAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-975s21c1
Sequence:CCGGCGAAACGGGTAGTAGTCTATGCTCGAGCATAGACTACTACCCGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-4430s1c1
Sequence:CCGGGCTTGCTACATCTTTCTCATTCTCGAGAATGAGAAAGATGTAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175244.3-1555s1c1
Sequence:CCGGCCAGGTTTATGAAGGTCTCAACTCGAGTTGAGACCTTCATAAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175244.3-662s1c1
Sequence:CCGGGCTATACAAAGGCTACTCTATCTCGAGATAGAGTAGCCTTTGTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-1576s1c1
Sequence:CCGGGCCTTCTGACAAGTATGAGAACTCGAGTTCTCATACTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-1109s1c1
Sequence:CCGGCGAATCGTTGAGTGTCGAGATCTCGAGATCTCGACACTCAACGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1109s21c1
Sequence:CCGGCGAATCGTTGAGTGTCGAGATCTCGAGATCTCGACACTCAACGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175244
VALIDATED
HECTD3 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1576s21c1
Sequence:CCGGGCCTTCTGACAAGTATGAGAACTCGAGTTCTCATACTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1083s21c1
Sequence:CCGGCCGTCCACCTTCCAATCATTGCTCGAGCAATGATTGGAAGGTGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-2829s21c1
Sequence:CCGGGCTTGCTTCCCTAGGTATTTACTCGAGTAAATACCTAGGGAAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-975s21c1
Sequence:CCGGCGAAACGGGTAGTAGTCTATGCTCGAGCATAGACTACTACCCGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-4430s1c1
Sequence:CCGGGCTTGCTACATCTTTCTCATTCTCGAGAATGAGAAAGATGTAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175244.3-1555s1c1
Sequence:CCGGCCAGGTTTATGAAGGTCTCAACTCGAGTTGAGACCTTCATAAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175244.3-662s1c1
Sequence:CCGGGCTATACAAAGGCTACTCTATCTCGAGATAGAGTAGCCTTTGTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-1576s1c1
Sequence:CCGGGCCTTCTGACAAGTATGAGAACTCGAGTTCTCATACTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-1109s1c1
Sequence:CCGGCGAATCGTTGAGTGTCGAGATCTCGAGATCTCGACACTCAACGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1109s21c1
Sequence:CCGGCGAATCGTTGAGTGTCGAGATCTCGAGATCTCGACACTCAACGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175244
VALIDATED
HECTD3 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1576s21c1
Sequence:CCGGGCCTTCTGACAAGTATGAGAACTCGAGTTCTCATACTTGTCAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1083s21c1
Sequence:CCGGCCGTCCACCTTCCAATCATTGCTCGAGCAATGATTGGAAGGTGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-2829s21c1
Sequence:CCGGGCTTGCTTCCCTAGGTATTTACTCGAGTAAATACCTAGGGAAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-975s21c1
Sequence:CCGGCGAAACGGGTAGTAGTCTATGCTCGAGCATAGACTACTACCCGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-4430s1c1
Sequence:CCGGGCTTGCTACATCTTTCTCATTCTCGAGAATGAGAAAGATGTAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175244.3-1555s1c1
Sequence:CCGGCCAGGTTTATGAAGGTCTCAACTCGAGTTGAGACCTTCATAAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175244.3-662s1c1
Sequence:CCGGGCTATACAAAGGCTACTCTATCTCGAGATAGAGTAGCCTTTGTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-1576s1c1
Sequence:CCGGGCCTTCTGACAAGTATGAGAACTCGAGTTCTCATACTTGTCAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175244.3-1109s1c1
Sequence:CCGGCGAATCGTTGAGTGTCGAGATCTCGAGATCTCGACACTCAACGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175244.3-1109s21c1
Sequence:CCGGCGAATCGTTGAGTGTCGAGATCTCGAGATCTCGACACTCAACGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371246
VALIDATED
HECTD3 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-2863s1c1
Sequence:CCGGCCGAGGTATTTCACCTCTTAACTCGAGTTAAGAGGTGAAATACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1828s1c1
Sequence:CCGGTGCCGAGACTTTGCCAAGTATCTCGAGATACTTGGCAAAGTCTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1543s1c1
Sequence:CCGGGCAGTCTTCACCCAGGTATATCTCGAGATATACCTGGGTGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1998s1c1
Sequence:CCGGCCTGGAAGTGATGGAAGGAATCTCGAGATTCCTTCCATCACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371246.2-956s1c1
Sequence:CCGGCAGATGACAACTTTATGCCAACTCGAGTTGGCATAAAGTTGTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371246
VALIDATED
HECTD3 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-2863s1c1
Sequence:CCGGCCGAGGTATTTCACCTCTTAACTCGAGTTAAGAGGTGAAATACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1828s1c1
Sequence:CCGGTGCCGAGACTTTGCCAAGTATCTCGAGATACTTGGCAAAGTCTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1543s1c1
Sequence:CCGGGCAGTCTTCACCCAGGTATATCTCGAGATATACCTGGGTGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1998s1c1
Sequence:CCGGCCTGGAAGTGATGGAAGGAATCTCGAGATTCCTTCCATCACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371246.2-956s1c1
Sequence:CCGGCAGATGACAACTTTATGCCAACTCGAGTTGGCATAAAGTTGTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371246
VALIDATED
HECTD3 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-2863s1c1
Sequence:CCGGCCGAGGTATTTCACCTCTTAACTCGAGTTAAGAGGTGAAATACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1828s1c1
Sequence:CCGGTGCCGAGACTTTGCCAAGTATCTCGAGATACTTGGCAAAGTCTCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1543s1c1
Sequence:CCGGGCAGTCTTCACCCAGGTATATCTCGAGATATACCTGGGTGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_371246.2-1998s1c1
Sequence:CCGGCCTGGAAGTGATGGAAGGAATCTCGAGATTCCTTCCATCACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371246.2-956s1c1
Sequence:CCGGCAGATGACAACTTTATGCCAACTCGAGTTGGCATAAAGTTGTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)