EMAIL THIS PAGE TO A FRIEND

HECTD4

HECT domain containing E3 ubiquitin protein ligase 4

80 Gene Product Result for
Synonyms: C12orf51
Gene ID:
sheep(101114978) HECT domain containing E3 ubiquitin protein ligase 4
domestic guinea pig(100721575) HECT domain containing E3 ubiquitin protein ligase 4
naked mole-rat(101724624) HECT domain containing E3 ubiquitin protein ligase 4
dog(477486) HECT domain containing E3 ubiquitin protein ligase 4
cow(534434) HECT domain containing E3 ubiquitin protein ligase 4
domestic cat(101084744) HECT domain containing E3 ubiquitin protein ligase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001109662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173813 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016201 MISSION® esiRNA esiRNA targeting human C12orf51 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109662 Rosetta Predictions human pricing
NM_173813 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324703 predicted 689
2 SASI_Hs02_00324704 predicted 489
3 SASI_Hs02_00324705 predicted 5960
4 SASI_Hs02_00324706 predicted 2705
5 SASI_Hs02_00324707 predicted 7812
6 SASI_Hs02_00324708 predicted 351
7 SASI_Hs02_00324709 predicted 2116
8 SASI_Hs02_00324710 predicted 9635
9 SASI_Hs02_00324711 predicted 1602
10 SASI_Hs02_00324712 predicted 7396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138684 predicted 992
2 SASI_Hs01_00138685 predicted 1462
3 SASI_Hs01_00138686 predicted 797
4 SASI_Hs01_00138687 predicted 1777
5 SASI_Hs01_00138688 predicted 1435
6 SASI_Hs01_00138689 predicted 260
7 SASI_Hs01_00138690 predicted 1782
8 SASI_Hs01_00138691 predicted 704
9 SASI_Hs01_00138692 predicted 1556
10 SASI_Hs01_00138693 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109662
VALIDATED
HECTD4 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000237814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-5383s21c1
Sequence:CCGGGCGTCAGACACATTGACTATTCTCGAGAATAGTCAATGTGTCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-398s21c1
Sequence:CCGGTGCGGAAGACACCCATATATACTCGAGTATATATGGGTGTCTTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-13682s21c1
Sequence:CCGGTGAAAGAGCCTTTCGATTTATCTCGAGATAAATCGAAAGGCTCTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-4594s21c1
Sequence:CCGGGATGGCAAGCTCTCGATATTTCTCGAGAAATATCGAGAGCTTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109662
VALIDATED
HECTD4 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000237814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-5383s21c1
Sequence:CCGGGCGTCAGACACATTGACTATTCTCGAGAATAGTCAATGTGTCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-398s21c1
Sequence:CCGGTGCGGAAGACACCCATATATACTCGAGTATATATGGGTGTCTTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-13682s21c1
Sequence:CCGGTGAAAGAGCCTTTCGATTTATCTCGAGATAAATCGAAAGGCTCTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-4594s21c1
Sequence:CCGGGATGGCAAGCTCTCGATATTTCTCGAGAAATATCGAGAGCTTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109662
VALIDATED
HECTD4 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000237814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-5383s21c1
Sequence:CCGGGCGTCAGACACATTGACTATTCTCGAGAATAGTCAATGTGTCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-398s21c1
Sequence:CCGGTGCGGAAGACACCCATATATACTCGAGTATATATGGGTGTCTTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-13682s21c1
Sequence:CCGGTGAAAGAGCCTTTCGATTTATCTCGAGATAAATCGAAAGGCTCTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001109662.1-4594s21c1
Sequence:CCGGGATGGCAAGCTCTCGATATTTCTCGAGAAATATCGAGAGCTTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173813
HECTD4 MISSION shRNA Bacterial Glycerol Stock
HECT domain containing E3 ubiquitin protein ligase 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173813.2-2441s1c1
Sequence:CCGGGCTAGGTTTATCTCTAGTATTCTCGAGAATACTAGAGATAAACCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-1428s1c1
Sequence:CCGGCGCTGCCTGTACCTTAGATTTCTCGAGAAATCTAAGGTACAGGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-2085s1c1
Sequence:CCGGCCTCAATTTAGACCAAGTATACTCGAGTATACTTGGTCTAAATTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-993s1c1
Sequence:CCGGGCCCTCATAAATAGTGACATACTCGAGTATGTCACTATTTATGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-309s1c1
Sequence:CCGGCGCTGCATTCTCGTTGTCTTTCTCGAGAAAGACAACGAGAATGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173813
HECTD4 MISSION shRNA shRNA Plasmid DNA
HECT domain containing E3 ubiquitin protein ligase 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173813.2-2441s1c1
Sequence:CCGGGCTAGGTTTATCTCTAGTATTCTCGAGAATACTAGAGATAAACCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-1428s1c1
Sequence:CCGGCGCTGCCTGTACCTTAGATTTCTCGAGAAATCTAAGGTACAGGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-2085s1c1
Sequence:CCGGCCTCAATTTAGACCAAGTATACTCGAGTATACTTGGTCTAAATTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-993s1c1
Sequence:CCGGGCCCTCATAAATAGTGACATACTCGAGTATGTCACTATTTATGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-309s1c1
Sequence:CCGGCGCTGCATTCTCGTTGTCTTTCTCGAGAAAGACAACGAGAATGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173813
HECTD4 MISSION shRNA Lentiviral Transduction Particles
HECT domain containing E3 ubiquitin protein ligase 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173813.2-2441s1c1
Sequence:CCGGGCTAGGTTTATCTCTAGTATTCTCGAGAATACTAGAGATAAACCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-1428s1c1
Sequence:CCGGCGCTGCCTGTACCTTAGATTTCTCGAGAAATCTAAGGTACAGGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-2085s1c1
Sequence:CCGGCCTCAATTTAGACCAAGTATACTCGAGTATACTTGGTCTAAATTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-993s1c1
Sequence:CCGGGCCCTCATAAATAGTGACATACTCGAGTATGTCACTATTTATGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173813.2-309s1c1
Sequence:CCGGCGCTGCATTCTCGTTGTCTTTCTCGAGAAAGACAACGAGAATGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)