EMAIL THIS PAGE TO A FRIEND

HECW1

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1

160 Gene Product Result for
Synonyms: NEDL1
UniProtKB ID: Q76N89, A7E2X0, A8MYS3, O15036, Q9HCC7
Gene ID:
Mouse(94253) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Rat(291209) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
chicken(420774) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
domestic cat(101087721) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
cow(514243) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
dog(475868) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
domestic guinea pig(100721705) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
naked mole-rat(101701199) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
sheep(101119205) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_484217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015052 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015052 Rosetta Predictions human pricing
NM_001106117 Rosetta Predictions rat pricing
NM_001081348 Rosetta Predictions mouse pricing
XM_897825 Rosetta Predictions mouse pricing
XM_897837 Rosetta Predictions mouse pricing
XM_897846 Rosetta Predictions mouse pricing
XM_897863 Rosetta Predictions mouse pricing
XM_897876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045712 predicted 3929
2 SASI_Hs01_00045713 predicted 5072
3 SASI_Hs01_00045714 predicted 3894
4 SASI_Hs02_00346899 predicted 4612
5 SASI_Hs01_00045715 predicted 4982
6 SASI_Hs01_00045716 predicted 4822
7 SASI_Hs02_00346900 predicted 3387
8 SASI_Hs01_00045718 predicted 853
9 SASI_Hs01_00045719 predicted 3944
10 SASI_Hs02_00346901 predicted 3511
11 SASI_Hs01_00045717 predicted 1586
12 SASI_Hs01_00045720 predicted 1069
13 SASI_Hs01_00045721 predicted 4198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215788 predicted 470
2 SASI_Rn02_00215789 predicted 2750
3 SASI_Rn02_00215790 predicted 4038
4 SASI_Rn02_00215791 predicted 434
5 SASI_Rn02_00215792 predicted 4268
6 SASI_Rn02_00215793 predicted 919
7 SASI_Rn02_00215794 predicted 382
8 SASI_Rn02_00215795 predicted 3595
9 SASI_Rn02_00215796 predicted 4914
10 SASI_Rn02_00215797 predicted 4886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297531 predicted 772
2 SASI_Mm02_00297532 predicted 1178
3 SASI_Mm02_00297533 predicted 3514
4 SASI_Mm02_00297534 predicted 3711
5 SASI_Mm02_00297535 predicted 4812
6 SASI_Mm02_00297536 predicted 5302
7 SASI_Mm02_00297537 predicted 3064
8 SASI_Mm02_00297538 predicted 4351
9 SASI_Mm02_00297539 predicted 683
10 SASI_Mm02_00297540 predicted 3396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281765 predicted 721
2 SASI_Mm01_00281766 predicted 1137
3 SASI_Mm01_00281767 predicted 1128
4 SASI_Mm01_00281768 predicted 397
5 SASI_Mm01_00281769 predicted 1178
6 SASI_Mm01_00281770 predicted 632
7 SASI_Mm01_00281771 predicted 721
8 SASI_Mm01_00281772 predicted 856
9 SASI_Mm01_00281773 predicted 1021
10 SASI_Mm01_00281774 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259032 predicted 1139
2 SASI_Mm01_00259033 predicted 722
3 SASI_Mm01_00259034 predicted 1136
4 SASI_Mm01_00259035 predicted 1123
5 SASI_Mm01_00259036 predicted 399
6 SASI_Mm01_00259037 predicted 640
7 SASI_Mm01_00259038 predicted 720
8 SASI_Mm01_00259039 predicted 854
9 SASI_Mm01_00259040 predicted 505
10 SASI_Mm01_00259041 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244229 predicted 1194
2 SASI_Mm01_00244230 predicted 785
3 SASI_Mm01_00244231 predicted 1193
4 SASI_Mm01_00244232 predicted 1188
5 SASI_Mm01_00244233 predicted 1233
6 SASI_Mm01_00244234 predicted 698
7 SASI_Mm01_00244235 predicted 779
8 SASI_Mm01_00244236 predicted 920
9 SASI_Mm01_00244237 predicted 1080
10 SASI_Mm01_00244238 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278706 predicted 3689
2 SASI_Mm01_00278707 predicted 1565
3 SASI_Mm01_00278708 predicted 3092
4 SASI_Mm01_00278709 predicted 4719
5 SASI_Mm01_00278710 predicted 1178
6 SASI_Mm01_00278711 predicted 2291
7 SASI_Mm01_00278712 predicted 1386
8 SASI_Mm01_00278713 predicted 2284
9 SASI_Mm01_00278714 predicted 1462
10 SASI_Mm01_00278715 predicted 2277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235652 predicted 3677
2 SASI_Mm01_00235653 predicted 1555
3 SASI_Mm01_00235654 predicted 3087
4 SASI_Mm01_00235655 predicted 4709
5 SASI_Mm01_00235656 predicted 1174
6 SASI_Mm01_00235657 predicted 2277
7 SASI_Mm01_00235658 predicted 1377
8 SASI_Mm01_00235659 predicted 2276
9 SASI_Mm01_00235660 predicted 1460
10 SASI_Mm01_00235661 predicted 2271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081348
HECW1 MISSION shRNA Bacterial Glycerol Stock
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000431449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081348.3-765s21c1
Sequence:CCGGTGGATTGGCATGTACCTTATTCTCGAGAATAAGGTACATGCCAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081348.3-3922s21c1
Sequence:CCGGGTGATGCAGATCTAGTCATTTCTCGAGAAATGACTAGATCTGCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081348.3-5686s21c1
Sequence:CCGGGACCTGGGAGCTGACTAATTTCTCGAGAAATTAGTCAGCTCCCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081348
HECW1 MISSION shRNA shRNA Plasmid DNA
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000431449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081348.3-765s21c1
Sequence:CCGGTGGATTGGCATGTACCTTATTCTCGAGAATAAGGTACATGCCAATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081348.3-3922s21c1
Sequence:CCGGGTGATGCAGATCTAGTCATTTCTCGAGAAATGACTAGATCTGCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081348.3-5686s21c1
Sequence:CCGGGACCTGGGAGCTGACTAATTTCTCGAGAAATTAGTCAGCTCCCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081348
HECW1 MISSION shRNA Lentiviral Transduction Particles
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000431449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081348.3-765s21c1
Sequence:CCGGTGGATTGGCATGTACCTTATTCTCGAGAATAAGGTACATGCCAATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081348.3-3922s21c1
Sequence:CCGGGTGATGCAGATCTAGTCATTTCTCGAGAAATGACTAGATCTGCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081348.3-5686s21c1
Sequence:CCGGGACCTGGGAGCTGACTAATTTCTCGAGAAATTAGTCAGCTCCCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484217
HECW1 MISSION shRNA Bacterial Glycerol Stock
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484217.2-6045s1c1
Sequence:CCGGGCCAAGTTTATTTACGTGATACTCGAGTATCACGTAAATAAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-3966s1c1
Sequence:CCGGGCTCCGCAATTTCTACCGAAACTCGAGTTTCGGTAGAAATTGCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-4101s1c1
Sequence:CCGGCCAGAGAAACAAGCTCTACATCTCGAGATGTAGAGCTTGTTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-414s1c1
Sequence:CCGGCCCAGACCAATTCCACAACATCTCGAGATGTTGTGGAATTGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-955s1c1
Sequence:CCGGCCCGACCCTTATCTGAAGATTCTCGAGAATCTTCAGATAAGGGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484217
HECW1 MISSION shRNA shRNA Plasmid DNA
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484217.2-6045s1c1
Sequence:CCGGGCCAAGTTTATTTACGTGATACTCGAGTATCACGTAAATAAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-3966s1c1
Sequence:CCGGGCTCCGCAATTTCTACCGAAACTCGAGTTTCGGTAGAAATTGCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-4101s1c1
Sequence:CCGGCCAGAGAAACAAGCTCTACATCTCGAGATGTAGAGCTTGTTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-414s1c1
Sequence:CCGGCCCAGACCAATTCCACAACATCTCGAGATGTTGTGGAATTGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-955s1c1
Sequence:CCGGCCCGACCCTTATCTGAAGATTCTCGAGAATCTTCAGATAAGGGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484217
HECW1 MISSION shRNA Lentiviral Transduction Particles
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484217.2-6045s1c1
Sequence:CCGGGCCAAGTTTATTTACGTGATACTCGAGTATCACGTAAATAAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-3966s1c1
Sequence:CCGGGCTCCGCAATTTCTACCGAAACTCGAGTTTCGGTAGAAATTGCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-4101s1c1
Sequence:CCGGCCAGAGAAACAAGCTCTACATCTCGAGATGTAGAGCTTGTTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-414s1c1
Sequence:CCGGCCCAGACCAATTCCACAACATCTCGAGATGTTGTGGAATTGGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484217.2-955s1c1
Sequence:CCGGCCCGACCCTTATCTGAAGATTCTCGAGAATCTTCAGATAAGGGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015052
HECW1 MISSION shRNA Bacterial Glycerol Stock
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015052.x-5387s1c1
Sequence:CCGGGCCTAGACATACGGTGCAAATCTCGAGATTTGCACCGTATGTCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-4167s1c1
Sequence:CCGGGACCTCACTTTCACTGTTAATCTCGAGATTAACAGTGAAAGTGAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-2966s1c1
Sequence:CCGGCCGGGACTTGGTGAATTTCATCTCGAGATGAAATTCACCAAGTCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-4428s1c1
Sequence:CCGGGACCTAAATGACTGGCGGAATCTCGAGATTCCGCCAGTCATTTAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-996s1c1
Sequence:CCGGCACCCAGATGATGAGGAGATTCTCGAGAATCTCCTCATCATCTGGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015052
HECW1 MISSION shRNA shRNA Plasmid DNA
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015052.x-5387s1c1
Sequence:CCGGGCCTAGACATACGGTGCAAATCTCGAGATTTGCACCGTATGTCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-4167s1c1
Sequence:CCGGGACCTCACTTTCACTGTTAATCTCGAGATTAACAGTGAAAGTGAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-2966s1c1
Sequence:CCGGCCGGGACTTGGTGAATTTCATCTCGAGATGAAATTCACCAAGTCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-4428s1c1
Sequence:CCGGGACCTAAATGACTGGCGGAATCTCGAGATTCCGCCAGTCATTTAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-996s1c1
Sequence:CCGGCACCCAGATGATGAGGAGATTCTCGAGAATCTCCTCATCATCTGGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015052
HECW1 MISSION shRNA Lentiviral Transduction Particles
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015052.x-5387s1c1
Sequence:CCGGGCCTAGACATACGGTGCAAATCTCGAGATTTGCACCGTATGTCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-4167s1c1
Sequence:CCGGGACCTCACTTTCACTGTTAATCTCGAGATTAACAGTGAAAGTGAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-2966s1c1
Sequence:CCGGCCGGGACTTGGTGAATTTCATCTCGAGATGAAATTCACCAAGTCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-4428s1c1
Sequence:CCGGGACCTAAATGACTGGCGGAATCTCGAGATTCCGCCAGTCATTTAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015052.x-996s1c1
Sequence:CCGGCACCCAGATGATGAGGAGATTCTCGAGAATCTCCTCATCATCTGGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)