EMAIL THIS PAGE TO A FRIEND

HECW2

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2

183 Gene Product Result for
Synonyms: NEDL2
UniProtKB ID: Q9P2P5, B8ZZB4, Q17RT5, Q68DF8, Q9NPS9
Gene ID:
Mouse(329152) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Rat(316395) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Zebrafish(100331355) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
chicken(424050) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
domestic cat(101087254) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Horse(100055015) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
cow(531691) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
dog(100685500) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
sheep(101119960) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Domestic Rabbit(100347483) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
domestic guinea pig(100724624) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
naked mole-rat(101713103) HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_355199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_038999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_038999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_038999 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020760 Rosetta Predictions human pricing
NM_001108218 Rosetta Predictions rat pricing
NM_001001883 Rosetta Predictions mouse pricing
NM_172655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201807 predicted 2644
2 SASI_Hs01_00201808 predicted 1181
3 SASI_Hs01_00201810 predicted 358
4 SASI_Hs01_00201811 predicted 4088
5 SASI_Hs01_00201812 predicted 884
6 SASI_Hs02_00353881 predicted 3989
7 SASI_Hs02_00353882 predicted 444
8 SASI_Hs01_00201813 predicted 3842
9 SASI_Hs01_00201815 predicted 2955
10 SASI_Hs01_00201816 predicted 2661
11 SASI_Hs01_00201809 predicted 4587
12 SASI_Hs01_00201814 predicted 3029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236484 predicted 4325
2 SASI_Rn02_00236485 predicted 1727
3 SASI_Rn02_00236486 predicted 4227
4 SASI_Rn02_00236487 predicted 418
5 SASI_Rn02_00236488 predicted 310
6 SASI_Rn02_00236489 predicted 2519
7 SASI_Rn02_00236490 predicted 4078
8 SASI_Rn02_00236491 predicted 3392
9 SASI_Rn02_00236492 predicted 4571
10 SASI_Rn02_00236493 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160458 predicted 417
2 SASI_Mm01_00160459 predicted 256
3 SASI_Mm01_00160460 predicted 383
4 SASI_Mm01_00160461 predicted 355
5 SASI_Mm01_00160462 predicted 277
6 SASI_Mm01_00160463 predicted 203
7 SASI_Mm01_00160464 predicted 270
8 SASI_Mm01_00160465 predicted 345
9 SASI_Mm01_00160466 predicted 267
10 SASI_Mm01_00160467 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051053 predicted 505
2 SASI_Mm01_00051054 predicted 358
3 SASI_Mm01_00051055 predicted 475
4 SASI_Mm01_00051056 predicted 447
5 SASI_Mm01_00051057 predicted 365
6 SASI_Mm01_00051058 predicted 301
7 SASI_Mm01_00051059 predicted 357
8 SASI_Mm01_00051060 predicted 441
9 SASI_Mm01_00051061 predicted 358
10 SASI_Mm01_00051062 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355199
HECW2 MISSION shRNA Bacterial Glycerol Stock
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-382s1c1
Sequence:CCGGGATTCCCTCAATGATTACTTACTCGAGTAAGTAATCATTGAGGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-1678s1c1
Sequence:CCGGCAGCTAAAGCAATGGCCTTTACTCGAGTAAAGGCCATTGCTTTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-698s1c1
Sequence:CCGGCCTCTATACATGAAACTGCATCTCGAGATGCAGTTTCATGTATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-2004s1c1
Sequence:CCGGGCGATCTAACTCCATACAGCACTCGAGTGCTGTATGGAGTTAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-538s1c1
Sequence:CCGGGACGAAGAAGACCATGAGTTTCTCGAGAAACTCATGGTCTTCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355199
HECW2 MISSION shRNA shRNA Plasmid DNA
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-382s1c1
Sequence:CCGGGATTCCCTCAATGATTACTTACTCGAGTAAGTAATCATTGAGGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-1678s1c1
Sequence:CCGGCAGCTAAAGCAATGGCCTTTACTCGAGTAAAGGCCATTGCTTTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-698s1c1
Sequence:CCGGCCTCTATACATGAAACTGCATCTCGAGATGCAGTTTCATGTATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-2004s1c1
Sequence:CCGGGCGATCTAACTCCATACAGCACTCGAGTGCTGTATGGAGTTAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-538s1c1
Sequence:CCGGGACGAAGAAGACCATGAGTTTCTCGAGAAACTCATGGTCTTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355199
HECW2 MISSION shRNA Lentiviral Transduction Particles
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-382s1c1
Sequence:CCGGGATTCCCTCAATGATTACTTACTCGAGTAAGTAATCATTGAGGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-1678s1c1
Sequence:CCGGCAGCTAAAGCAATGGCCTTTACTCGAGTAAAGGCCATTGCTTTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-698s1c1
Sequence:CCGGCCTCTATACATGAAACTGCATCTCGAGATGCAGTTTCATGTATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-2004s1c1
Sequence:CCGGGCGATCTAACTCCATACAGCACTCGAGTGCTGTATGGAGTTAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355199.1-538s1c1
Sequence:CCGGGACGAAGAAGACCATGAGTTTCTCGAGAAACTCATGGTCTTCTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172655
HECW2 MISSION shRNA Bacterial Glycerol Stock
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-482s1c1
Sequence:CCGGCTACTTCATGGAACCGGAGATCTCGAGATCTCCGGTTCCATGAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-320s1c1
Sequence:CCGGCCTCATTATCTTCTGGGACATCTCGAGATGTCCCAGAAGATAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-779s1c1
Sequence:CCGGGCAGGAGAGAAGGTCCACTATCTCGAGATAGTGGACCTTCTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-698s1c1
Sequence:CCGGGTTCTTCAATCCTGACCCTTACTCGAGTAAGGGTCAGGATTGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-683s1c1
Sequence:CCGGGCTCAAGAAAGGGATGTTCTTCTCGAGAAGAACATCCCTTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172655
HECW2 MISSION shRNA shRNA Plasmid DNA
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-482s1c1
Sequence:CCGGCTACTTCATGGAACCGGAGATCTCGAGATCTCCGGTTCCATGAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-320s1c1
Sequence:CCGGCCTCATTATCTTCTGGGACATCTCGAGATGTCCCAGAAGATAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-779s1c1
Sequence:CCGGGCAGGAGAGAAGGTCCACTATCTCGAGATAGTGGACCTTCTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-698s1c1
Sequence:CCGGGTTCTTCAATCCTGACCCTTACTCGAGTAAGGGTCAGGATTGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-683s1c1
Sequence:CCGGGCTCAAGAAAGGGATGTTCTTCTCGAGAAGAACATCCCTTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172655
HECW2 MISSION shRNA Lentiviral Transduction Particles
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-482s1c1
Sequence:CCGGCTACTTCATGGAACCGGAGATCTCGAGATCTCCGGTTCCATGAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-320s1c1
Sequence:CCGGCCTCATTATCTTCTGGGACATCTCGAGATGTCCCAGAAGATAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-779s1c1
Sequence:CCGGGCAGGAGAGAAGGTCCACTATCTCGAGATAGTGGACCTTCTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-698s1c1
Sequence:CCGGGTTCTTCAATCCTGACCCTTACTCGAGTAAGGGTCAGGATTGAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172655.1-683s1c1
Sequence:CCGGGCTCAAGAAAGGGATGTTCTTCTCGAGAAGAACATCCCTTTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_038999
HECW2 MISSION shRNA Bacterial Glycerol Stock
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038999.2-6549s1c1
Sequence:CCGGGCCCAAACATTTCTTTGAGATCTCGAGATCTCAAAGAAATGTTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-801s1c1
Sequence:CCGGCCCTTATCTTAAGATGTCAATCTCGAGATTGACATCTTAAGATAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-3421s1c1
Sequence:CCGGGCTTACAATGACAAGATTGTTCTCGAGAACAATCTTGTCATTGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-1190s1c1
Sequence:CCGGGCACAATACTTGGAGTCAATTCTCGAGAATTGACTCCAAGTATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-3820s1c1
Sequence:CCGGCCAGGGAAGTTAAAGTTAATTCTCGAGAATTAACTTTAACTTCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_038999
HECW2 MISSION shRNA shRNA Plasmid DNA
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038999.2-6549s1c1
Sequence:CCGGGCCCAAACATTTCTTTGAGATCTCGAGATCTCAAAGAAATGTTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-801s1c1
Sequence:CCGGCCCTTATCTTAAGATGTCAATCTCGAGATTGACATCTTAAGATAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-3421s1c1
Sequence:CCGGGCTTACAATGACAAGATTGTTCTCGAGAACAATCTTGTCATTGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-1190s1c1
Sequence:CCGGGCACAATACTTGGAGTCAATTCTCGAGAATTGACTCCAAGTATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-3820s1c1
Sequence:CCGGCCAGGGAAGTTAAAGTTAATTCTCGAGAATTAACTTTAACTTCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_038999
HECW2 MISSION shRNA Lentiviral Transduction Particles
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_038999.2-6549s1c1
Sequence:CCGGGCCCAAACATTTCTTTGAGATCTCGAGATCTCAAAGAAATGTTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-801s1c1
Sequence:CCGGCCCTTATCTTAAGATGTCAATCTCGAGATTGACATCTTAAGATAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-3421s1c1
Sequence:CCGGGCTTACAATGACAAGATTGTTCTCGAGAACAATCTTGTCATTGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-1190s1c1
Sequence:CCGGGCACAATACTTGGAGTCAATTCTCGAGAATTGACTCCAAGTATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038999.2-3820s1c1
Sequence:CCGGCCAGGGAAGTTAAAGTTAATTCTCGAGAATTAACTTTAACTTCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)