EMAIL THIS PAGE TO A FRIEND

HELB

helicase (DNA) B

56 Gene Product Result for
Synonyms: hDHB
UniProtKB ID: Q8NG08, A8K4C9, Q4G0T2, Q9H7L5
Gene ID:
Human(92797) Summary: This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. [provided by RefSeq, Mar 2012]
Mouse(117599) helicase (DNA) B
Rat(500837) helicase (DNA) B
Zebrafish(797342) helicase (DNA) B
cow(614572) helicase (DNA) B
Horse(100058069) helicase (DNA) B
domestic cat(101090530) helicase (DNA) B
dog(608595) helicase (DNA) B
chicken(417836) helicase (DNA) B
sheep(101108210) helicase (DNA) B
Domestic Rabbit(100338890) helicase (DNA) B
naked mole-rat(101704051) helicase (DNA) B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36518 Anti-HELB antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033647 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034651 MISSION® esiRNA esiRNA targeting mouse Helb (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033647 Rosetta Predictions human pricing
XM_001081027 Rosetta Predictions rat pricing
XM_576229 Rosetta Predictions rat pricing
NM_080446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117288 predicted 1645
2 SASI_Hs01_00117289 predicted 1570
3 SASI_Hs01_00117290 predicted 1134
4 SASI_Hs02_00361460 predicted 1799
5 SASI_Hs01_00117291 predicted 2321
6 SASI_Hs02_00361461 predicted 936
7 SASI_Hs01_00117292 predicted 1883
8 SASI_Hs01_00117294 predicted 316
9 SASI_Hs01_00117295 predicted 225
10 SASI_Hs01_00117296 predicted 1290
11 SASI_Hs01_00117293 predicted 1857
12 SASI_Hs01_00117297 predicted 3077
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370281 predicted 616
2 SASI_Rn02_00370282 predicted 1832
3 SASI_Rn02_00370283 predicted 1789
4 SASI_Rn02_00370284 predicted 2449
5 SASI_Rn02_00370285 predicted 1813
6 SASI_Rn02_00370286 predicted 1388
7 SASI_Rn02_00370287 predicted 1614
8 SASI_Rn02_00370288 predicted 1736
9 SASI_Rn02_00370289 predicted 2377
10 SASI_Rn02_00370290 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404907 predicted 370
2 SASI_Rn02_00404908 predicted 997
3 SASI_Rn02_00404909 predicted 615
4 SASI_Rn02_00404910 predicted 209
5 SASI_Rn02_00404911 predicted 2764
6 SASI_Rn02_00404912 predicted 1392
7 SASI_Rn02_00404913 predicted 754
8 SASI_Rn02_00404914 predicted 1136
9 SASI_Rn02_00404915 predicted 2760
10 SASI_Rn02_00404916 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064184 predicted 1082
2 SASI_Mm01_00064185 predicted 1916
3 SASI_Mm01_00064186 predicted 2635
4 SASI_Mm01_00064187 predicted 2073
5 SASI_Mm01_00064188 predicted 720
6 SASI_Mm01_00064190 predicted 2792
7 SASI_Mm01_00064191 predicted 938
8 SASI_Mm01_00064192 predicted 1013
9 SASI_Mm01_00064193 predicted 946
10 SASI_Mm02_00338103 predicted 413
11 SASI_Mm01_00064189 predicted 2968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080446
VALIDATED
HELB MISSION shRNA Bacterial Glycerol Stock
helicase (DNA) B
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1715s21c1
Sequence:CCGGACGCTGTGCCAGGTCAATTACCTCGAGGTAATTGACCTGGCACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1219s21c1
Sequence:CCGGGAACGTCCTGGCGTCAATTAGCTCGAGCTAATTGACGCCAGGACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-844s21c1
Sequence:CCGGGAGGATAACCTACAGAGAAATCTCGAGATTTCTCTGTAGGTTATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-769s1c1
Sequence:CCGGGAGGATAACCTACAGAGAAATCTCGAGATTTCTCTGTAGGTTATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-1843s1c1
Sequence:CCGGGCCCAGTATTGAACCTGGTAACTCGAGTTACCAGGTTCAATACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-943s1c1
Sequence:CCGGGAAGAATGCATTGGTCATATACTCGAGTATATGACCAATGCATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-1087s1c1
Sequence:CCGGGGACATTGACGTGGTCATTTACTCGAGTAAATGACCACGTCAATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-283s1c1
Sequence:CCGGGTCTATCCCTGATGAGTATACCTCGAGGTATACTCATCAGGGATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1918s21c1
Sequence:CCGGGCCCAGTATTGAACCTGGTAACTCGAGTTACCAGGTTCAATACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-4288s1c1
Sequence:CCGGCCTGATCCTAAACATAACTTTCTCGAGAAAGTTATGTTTAGGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-1300s1c1
Sequence:CCGGCGTCGCAAATGCAGAAATAAACTCGAGTTTATTTCTGCATTTGCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.1-2982s1c1
Sequence:CCGGCTGTTAACGATGACGTGGATACTCGAGTATCCACGTCATCGTTAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080446.2-4364s21c1
Sequence:CCGGCCTGATCCTAAACATAACTTTCTCGAGAAAGTTATGTTTAGGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080446
VALIDATED
HELB MISSION shRNA shRNA Plasmid DNA
helicase (DNA) B
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1715s21c1
Sequence:CCGGACGCTGTGCCAGGTCAATTACCTCGAGGTAATTGACCTGGCACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1219s21c1
Sequence:CCGGGAACGTCCTGGCGTCAATTAGCTCGAGCTAATTGACGCCAGGACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-844s21c1
Sequence:CCGGGAGGATAACCTACAGAGAAATCTCGAGATTTCTCTGTAGGTTATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-769s1c1
Sequence:CCGGGAGGATAACCTACAGAGAAATCTCGAGATTTCTCTGTAGGTTATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-1843s1c1
Sequence:CCGGGCCCAGTATTGAACCTGGTAACTCGAGTTACCAGGTTCAATACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-943s1c1
Sequence:CCGGGAAGAATGCATTGGTCATATACTCGAGTATATGACCAATGCATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-1087s1c1
Sequence:CCGGGGACATTGACGTGGTCATTTACTCGAGTAAATGACCACGTCAATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-283s1c1
Sequence:CCGGGTCTATCCCTGATGAGTATACCTCGAGGTATACTCATCAGGGATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1918s21c1
Sequence:CCGGGCCCAGTATTGAACCTGGTAACTCGAGTTACCAGGTTCAATACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-4288s1c1
Sequence:CCGGCCTGATCCTAAACATAACTTTCTCGAGAAAGTTATGTTTAGGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-1300s1c1
Sequence:CCGGCGTCGCAAATGCAGAAATAAACTCGAGTTTATTTCTGCATTTGCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.1-2982s1c1
Sequence:CCGGCTGTTAACGATGACGTGGATACTCGAGTATCCACGTCATCGTTAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080446.2-4364s21c1
Sequence:CCGGCCTGATCCTAAACATAACTTTCTCGAGAAAGTTATGTTTAGGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080446
VALIDATED
HELB MISSION shRNA Lentiviral Transduction Particles
helicase (DNA) B
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1715s21c1
Sequence:CCGGACGCTGTGCCAGGTCAATTACCTCGAGGTAATTGACCTGGCACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1219s21c1
Sequence:CCGGGAACGTCCTGGCGTCAATTAGCTCGAGCTAATTGACGCCAGGACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-844s21c1
Sequence:CCGGGAGGATAACCTACAGAGAAATCTCGAGATTTCTCTGTAGGTTATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-769s1c1
Sequence:CCGGGAGGATAACCTACAGAGAAATCTCGAGATTTCTCTGTAGGTTATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-1843s1c1
Sequence:CCGGGCCCAGTATTGAACCTGGTAACTCGAGTTACCAGGTTCAATACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-943s1c1
Sequence:CCGGGAAGAATGCATTGGTCATATACTCGAGTATATGACCAATGCATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-1087s1c1
Sequence:CCGGGGACATTGACGTGGTCATTTACTCGAGTAAATGACCACGTCAATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.2-283s1c1
Sequence:CCGGGTCTATCCCTGATGAGTATACCTCGAGGTATACTCATCAGGGATAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080446.2-1918s21c1
Sequence:CCGGGCCCAGTATTGAACCTGGTAACTCGAGTTACCAGGTTCAATACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-4288s1c1
Sequence:CCGGCCTGATCCTAAACATAACTTTCTCGAGAAAGTTATGTTTAGGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080446.1-1300s1c1
Sequence:CCGGCGTCGCAAATGCAGAAATAAACTCGAGTTTATTTCTGCATTTGCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080446.1-2982s1c1
Sequence:CCGGCTGTTAACGATGACGTGGATACTCGAGTATCCACGTCATCGTTAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080446.2-4364s21c1
Sequence:CCGGCCTGATCCTAAACATAACTTTCTCGAGAAAGTTATGTTTAGGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033647
HELB MISSION shRNA Bacterial Glycerol Stock
helicase (DNA) B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-212s1c1
Sequence:CCGGCGCGTTTCTATTTGTGATGAACTCGAGTTCATCACAAATAGAAACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-2498s1c1
Sequence:CCGGCGTGACTTTGAAAGTAACGTTCTCGAGAACGTTACTTTCAAAGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1916s1c1
Sequence:CCGGCCTGGTAACTTGCTGAAAGATCTCGAGATCTTTCAGCAAGTTACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1778s1c1
Sequence:CCGGGTTAGAGTTCTGGTTGTGGATCTCGAGATCCACAACCAGAACTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1658s1c1
Sequence:CCGGGCTGGCTTACTAAGACAGAAACTCGAGTTTCTGTCTTAGTAAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-373s1c1
Sequence:CCGGGTCTGATATGTCACCACCAAACTCGAGTTTGGTGGTGACATATCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-211s1c1
Sequence:CCGGCCGCGTTTCTATTTGTGATGACTCGAGTCATCACAAATAGAAACGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1292s1c1
Sequence:CCGGCAGGACAATGGTGACCATATTCTCGAGAATATGGTCACCATTGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-2704s1c1
Sequence:CCGGCGAGGAGCAAACAGTTGTCTACTCGAGTAGACAACTGTTTGCTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1913s1c1
Sequence:CCGGGAACCTGGTAACTTGCTGAAACTCGAGTTTCAGCAAGTTACCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1151s1c1
Sequence:CCGGCCTTGGCATTTATGTGTCGATCTCGAGATCGACACATAAATGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033647
HELB MISSION shRNA shRNA Plasmid DNA
helicase (DNA) B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-212s1c1
Sequence:CCGGCGCGTTTCTATTTGTGATGAACTCGAGTTCATCACAAATAGAAACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-2498s1c1
Sequence:CCGGCGTGACTTTGAAAGTAACGTTCTCGAGAACGTTACTTTCAAAGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1916s1c1
Sequence:CCGGCCTGGTAACTTGCTGAAAGATCTCGAGATCTTTCAGCAAGTTACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1778s1c1
Sequence:CCGGGTTAGAGTTCTGGTTGTGGATCTCGAGATCCACAACCAGAACTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1658s1c1
Sequence:CCGGGCTGGCTTACTAAGACAGAAACTCGAGTTTCTGTCTTAGTAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-373s1c1
Sequence:CCGGGTCTGATATGTCACCACCAAACTCGAGTTTGGTGGTGACATATCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-211s1c1
Sequence:CCGGCCGCGTTTCTATTTGTGATGACTCGAGTCATCACAAATAGAAACGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1292s1c1
Sequence:CCGGCAGGACAATGGTGACCATATTCTCGAGAATATGGTCACCATTGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-2704s1c1
Sequence:CCGGCGAGGAGCAAACAGTTGTCTACTCGAGTAGACAACTGTTTGCTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1913s1c1
Sequence:CCGGGAACCTGGTAACTTGCTGAAACTCGAGTTTCAGCAAGTTACCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1151s1c1
Sequence:CCGGCCTTGGCATTTATGTGTCGATCTCGAGATCGACACATAAATGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033647
HELB MISSION shRNA Lentiviral Transduction Particles
helicase (DNA) B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-212s1c1
Sequence:CCGGCGCGTTTCTATTTGTGATGAACTCGAGTTCATCACAAATAGAAACGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-2498s1c1
Sequence:CCGGCGTGACTTTGAAAGTAACGTTCTCGAGAACGTTACTTTCAAAGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1916s1c1
Sequence:CCGGCCTGGTAACTTGCTGAAAGATCTCGAGATCTTTCAGCAAGTTACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1778s1c1
Sequence:CCGGGTTAGAGTTCTGGTTGTGGATCTCGAGATCCACAACCAGAACTCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1658s1c1
Sequence:CCGGGCTGGCTTACTAAGACAGAAACTCGAGTTTCTGTCTTAGTAAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-373s1c1
Sequence:CCGGGTCTGATATGTCACCACCAAACTCGAGTTTGGTGGTGACATATCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-211s1c1
Sequence:CCGGCCGCGTTTCTATTTGTGATGACTCGAGTCATCACAAATAGAAACGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1292s1c1
Sequence:CCGGCAGGACAATGGTGACCATATTCTCGAGAATATGGTCACCATTGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-2704s1c1
Sequence:CCGGCGAGGAGCAAACAGTTGTCTACTCGAGTAGACAACTGTTTGCTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1913s1c1
Sequence:CCGGGAACCTGGTAACTTGCTGAAACTCGAGTTTCAGCAAGTTACCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033647.2-1151s1c1
Sequence:CCGGCCTTGGCATTTATGTGTCGATCTCGAGATCGACACATAAATGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)