EMAIL THIS PAGE TO A FRIEND

HELLS

helicase, lymphoid-specific

87 Gene Product Result for
Synonyms: LSH PASG SMARCA6
Gene ID:
Human(3070) Summary: This gene encodes a lymphoid-specific helicase. Other helicases function in processes involving DNA strand separation, including replication, repair, recombination, and transcription. This protein is thought to be involved with cellular proliferation and may play a role in leukemogenesis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(15201) helicase, lymphoid specific
Rat(294071) helicase, lymphoid specific
Zebrafish(553328) helicase, lymphoid-specific
chicken(423750) helicase, lymphoid-specific
dog(486809) helicase, lymphoid-specific
cow(540933) helicase, lymphoid-specific
Horse(100061642) helicase, lymphoid-specific
domestic cat(101095378) helicase, lymphoid-specific
domestic guinea pig(100722395) helicase, lymphoid-specific
naked mole-rat(101707644) helicase, lymphoid-specific
sheep(101106217) helicase, lymphoid-specific
Domestic Rabbit(100344939) helicase, lymphoid-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018063 Rosetta Predictions human pricing
NM_001106371 Rosetta Predictions rat pricing
NM_008234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026584 predicted 2477
2 SASI_Hs01_00026585 predicted 2375
3 SASI_Hs02_00351205 predicted 1551
4 SASI_Hs01_00026586 predicted 980
5 SASI_Hs01_00026587 predicted 1198
6 SASI_Hs01_00026588 predicted 1179
7 SASI_Hs01_00026589 predicted 872
8 SASI_Hs01_00026590 predicted 1070
9 SASI_Hs01_00026591 predicted 955
10 SASI_Hs02_00351206 predicted 1408
11 SASI_Hs01_00026592 predicted 2305
12 SASI_Hs01_00026593 predicted 2458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218308 predicted 1436
2 SASI_Rn02_00218309 predicted 1101
3 SASI_Rn02_00218310 predicted 2193
4 SASI_Rn02_00218311 predicted 2621
5 SASI_Rn02_00218312 predicted 1045
6 SASI_Rn02_00218313 predicted 1520
7 SASI_Rn02_00218314 predicted 1160
8 SASI_Rn02_00218315 predicted 1393
9 SASI_Rn02_00218316 predicted 1371
10 SASI_Rn02_00218317 predicted 2446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313423 predicted 2271
2 SASI_Mm01_00112134 predicted 1692
3 SASI_Mm01_00112136 predicted 2197
4 SASI_Mm01_00112137 predicted 2211
5 SASI_Mm01_00112138 predicted 893
6 SASI_Mm01_00112139 predicted 1488
7 SASI_Mm01_00112140 predicted 800
8 SASI_Mm01_00112141 predicted 2157
9 SASI_Mm01_00112142 predicted 1128
10 SASI_Mm01_00112143 predicted 1762
11 SASI_Mm01_00112135 predicted 2388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018063
VALIDATED
HELLS MISSION shRNA Bacterial Glycerol Stock
helicase, lymphoid-specific
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1744s1c1
Sequence:CCGGGAAGTGAATATCCCTGTAGAACTCGAGTTCTACAGGGATATTCACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1308s1c1
Sequence:CCGGGCCAGATGTATTTGATGACTTCTCGAGAAGTCATCAAATACATCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-2254s1c1
Sequence:CCGGGTTGTTGTTTATCGCCTTGTTCTCGAGAACAAGGCGATAAACAACAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1185s1c1
Sequence:CCGGGAATATGAAGTGCCGTCTAATCTCGAGATTAGACGGCACTTCATATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1585s1c1
Sequence:CCGGTCCAGTGAGAAAGAAACAATTCTCGAGAATTGTTTCTTTCTCACTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-2462s21c1
Sequence:CCGGGATCAAGAGAGAAGGTCATTACTCGAGTAATGACCTTCTCTCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018063.3-1185s21c1
Sequence:CCGGGAATATGAAGTGCCGTCTAATCTCGAGATTAGACGGCACTTCATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018063.3-1308s21c1
Sequence:CCGGGCCAGATGTATTTGATGACTTCTCGAGAAGTCATCAAATACATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-2789s21c1
Sequence:CCGGGAACAAAGAAGTATCCATATTCTCGAGAATATGGATACTTCTTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-1744s21c1
Sequence:CCGGGAAGTGAATATCCCTGTAGAACTCGAGTTCTACAGGGATATTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018063
VALIDATED
HELLS MISSION shRNA shRNA Plasmid DNA
helicase, lymphoid-specific
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1744s1c1
Sequence:CCGGGAAGTGAATATCCCTGTAGAACTCGAGTTCTACAGGGATATTCACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1308s1c1
Sequence:CCGGGCCAGATGTATTTGATGACTTCTCGAGAAGTCATCAAATACATCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-2254s1c1
Sequence:CCGGGTTGTTGTTTATCGCCTTGTTCTCGAGAACAAGGCGATAAACAACAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1185s1c1
Sequence:CCGGGAATATGAAGTGCCGTCTAATCTCGAGATTAGACGGCACTTCATATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1585s1c1
Sequence:CCGGTCCAGTGAGAAAGAAACAATTCTCGAGAATTGTTTCTTTCTCACTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-2462s21c1
Sequence:CCGGGATCAAGAGAGAAGGTCATTACTCGAGTAATGACCTTCTCTCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018063.3-1185s21c1
Sequence:CCGGGAATATGAAGTGCCGTCTAATCTCGAGATTAGACGGCACTTCATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018063.3-1308s21c1
Sequence:CCGGGCCAGATGTATTTGATGACTTCTCGAGAAGTCATCAAATACATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-2789s21c1
Sequence:CCGGGAACAAAGAAGTATCCATATTCTCGAGAATATGGATACTTCTTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-1744s21c1
Sequence:CCGGGAAGTGAATATCCCTGTAGAACTCGAGTTCTACAGGGATATTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018063
VALIDATED
HELLS MISSION shRNA Lentiviral Transduction Particles
helicase, lymphoid-specific
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1744s1c1
Sequence:CCGGGAAGTGAATATCCCTGTAGAACTCGAGTTCTACAGGGATATTCACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1308s1c1
Sequence:CCGGGCCAGATGTATTTGATGACTTCTCGAGAAGTCATCAAATACATCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-2254s1c1
Sequence:CCGGGTTGTTGTTTATCGCCTTGTTCTCGAGAACAAGGCGATAAACAACAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1185s1c1
Sequence:CCGGGAATATGAAGTGCCGTCTAATCTCGAGATTAGACGGCACTTCATATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018063.x-1585s1c1
Sequence:CCGGTCCAGTGAGAAAGAAACAATTCTCGAGAATTGTTTCTTTCTCACTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-2462s21c1
Sequence:CCGGGATCAAGAGAGAAGGTCATTACTCGAGTAATGACCTTCTCTCTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018063.3-1185s21c1
Sequence:CCGGGAATATGAAGTGCCGTCTAATCTCGAGATTAGACGGCACTTCATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018063.3-1308s21c1
Sequence:CCGGGCCAGATGTATTTGATGACTTCTCGAGAAGTCATCAAATACATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-2789s21c1
Sequence:CCGGGAACAAAGAAGTATCCATATTCTCGAGAATATGGATACTTCTTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018063.3-1744s21c1
Sequence:CCGGGAAGTGAATATCCCTGTAGAACTCGAGTTCTACAGGGATATTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008234
VALIDATED
HELLS MISSION shRNA Bacterial Glycerol Stock
helicase, lymphoid-specific
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1177s1c1
Sequence:CCGGCCGGCTAATCAGGGAGTTAAACTCGAGTTTAACTCCCTGATTAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1766s1c1
Sequence:CCGGCGGAATATAATGATGCTACTTCTCGAGAAGTAGCATCATTATATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1010s1c1
Sequence:CCGGCGTCGGAAATTAGTAAAGAATCTCGAGATTCTTTACTAATTTCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-582s1c1
Sequence:CCGGCGAGTCTTTGTGTAGAAGATACTCGAGTATCTTCTACACAAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008234.2-2258s1c1
Sequence:CCGGGCAAATACTATTGACCAGAAACTCGAGTTTCTGGTCAATAGTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008234.3-2602s21c1
Sequence:CCGGTTACATCCATTCTGGTAATTTCTCGAGAAATTACCAGAATGGATGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-1867s21c1
Sequence:CCGGTCGAATGCTGCCCGAACTTAACTCGAGTTAAGTTCGGGCAGCATTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-549s21c1
Sequence:CCGGCGAGTCTTTGTGTAGAAGATACTCGAGTATCTTCTACACAAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-1144s21c1
Sequence:CCGGCCGGCTAATCAGGGAGTTAAACTCGAGTTTAACTCCCTGATTAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-977s21c1
Sequence:CCGGCGTCGGAAATTAGTAAAGAATCTCGAGATTCTTTACTAATTTCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008234
VALIDATED
HELLS MISSION shRNA shRNA Plasmid DNA
helicase, lymphoid-specific
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1177s1c1
Sequence:CCGGCCGGCTAATCAGGGAGTTAAACTCGAGTTTAACTCCCTGATTAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1766s1c1
Sequence:CCGGCGGAATATAATGATGCTACTTCTCGAGAAGTAGCATCATTATATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1010s1c1
Sequence:CCGGCGTCGGAAATTAGTAAAGAATCTCGAGATTCTTTACTAATTTCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-582s1c1
Sequence:CCGGCGAGTCTTTGTGTAGAAGATACTCGAGTATCTTCTACACAAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008234.2-2258s1c1
Sequence:CCGGGCAAATACTATTGACCAGAAACTCGAGTTTCTGGTCAATAGTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008234.3-2602s21c1
Sequence:CCGGTTACATCCATTCTGGTAATTTCTCGAGAAATTACCAGAATGGATGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-1867s21c1
Sequence:CCGGTCGAATGCTGCCCGAACTTAACTCGAGTTAAGTTCGGGCAGCATTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-549s21c1
Sequence:CCGGCGAGTCTTTGTGTAGAAGATACTCGAGTATCTTCTACACAAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-1144s21c1
Sequence:CCGGCCGGCTAATCAGGGAGTTAAACTCGAGTTTAACTCCCTGATTAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-977s21c1
Sequence:CCGGCGTCGGAAATTAGTAAAGAATCTCGAGATTCTTTACTAATTTCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008234
VALIDATED
HELLS MISSION shRNA Lentiviral Transduction Particles
helicase, lymphoid-specific
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1177s1c1
Sequence:CCGGCCGGCTAATCAGGGAGTTAAACTCGAGTTTAACTCCCTGATTAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1766s1c1
Sequence:CCGGCGGAATATAATGATGCTACTTCTCGAGAAGTAGCATCATTATATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-1010s1c1
Sequence:CCGGCGTCGGAAATTAGTAAAGAATCTCGAGATTCTTTACTAATTTCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008234.2-582s1c1
Sequence:CCGGCGAGTCTTTGTGTAGAAGATACTCGAGTATCTTCTACACAAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008234.2-2258s1c1
Sequence:CCGGGCAAATACTATTGACCAGAAACTCGAGTTTCTGGTCAATAGTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008234.3-2602s21c1
Sequence:CCGGTTACATCCATTCTGGTAATTTCTCGAGAAATTACCAGAATGGATGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-1867s21c1
Sequence:CCGGTCGAATGCTGCCCGAACTTAACTCGAGTTAAGTTCGGGCAGCATTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-549s21c1
Sequence:CCGGCGAGTCTTTGTGTAGAAGATACTCGAGTATCTTCTACACAAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-1144s21c1
Sequence:CCGGCCGGCTAATCAGGGAGTTAAACTCGAGTTTAACTCCCTGATTAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008234.3-977s21c1
Sequence:CCGGCGTCGGAAATTAGTAAAGAATCTCGAGATTCTTTACTAATTTCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)