EMAIL THIS PAGE TO A FRIEND

HELQ

helicase, POLQ-like

85 Gene Product Result for
Synonyms: HEL308
Gene ID:
Human(113510) Summary: HEL308 is a single-stranded DNA-dependent ATPase and DNA helicase (Marini and Wood, 2002 [PubMed 11751861]
Mouse(191578) helicase, POLQ-like
Rat(360912) helicase, POLQ-like
sheep(101118875) helicase, POLQ-like
Domestic Rabbit(100349596) helicase, POLQ-like
domestic guinea pig(100721608) helicase, POLQ-like
naked mole-rat(101722327) helicase, POLQ-like
Zebrafish(562952) helicase, POLQ-like
chicken(422606) helicase, POLQ-like
cow(539372) helicase, POLQ-like
domestic cat(101084444) helicase, POLQ-like
dog(487837) helicase, POLQ-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133636 Rosetta Predictions human pricing
XM_001060858 Rosetta Predictions rat pricing
XM_341186 Rosetta Predictions rat pricing
NM_001081107 Rosetta Predictions mouse pricing
XM_132236 Rosetta Predictions mouse pricing
XM_984672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363269 predicted 1653
2 SASI_Hs01_00031129 predicted 2635
3 SASI_Hs01_00031130 predicted 2085
4 SASI_Hs02_00363270 predicted 2963
5 SASI_Hs01_00031132 predicted 2818
6 SASI_Hs01_00031133 predicted 707
7 SASI_Hs01_00031134 predicted 1104
8 SASI_Hs01_00031135 predicted 757
9 SASI_Hs01_00031136 predicted 2118
10 SASI_Hs01_00031137 predicted 1433
11 SASI_Hs01_00031131 predicted 628
12 SASI_Hs01_00031138 predicted 2454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297943 predicted 1033
2 SASI_Rn02_00297944 predicted 2443
3 SASI_Rn02_00297945 predicted 2845
4 SASI_Rn02_00297946 predicted 2759
5 SASI_Rn02_00297947 predicted 1978
6 SASI_Rn02_00297948 predicted 2587
7 SASI_Rn02_00297949 predicted 657
8 SASI_Rn02_00297950 predicted 3105
9 SASI_Rn02_00297951 predicted 573
10 SASI_Rn02_00297952 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392553 predicted 2458
2 SASI_Rn02_00392554 predicted 2372
3 SASI_Rn02_00392555 predicted 1922
4 SASI_Rn02_00392556 predicted 2450
5 SASI_Rn02_00392557 predicted 1589
6 SASI_Rn02_00392558 predicted 1981
7 SASI_Rn02_00392559 predicted 1613
8 SASI_Rn02_00392560 predicted 1525
9 SASI_Rn02_00392561 predicted 2383
10 SASI_Rn02_00392562 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295251 predicted 481
2 SASI_Mm02_00295252 predicted 2522
3 SASI_Mm02_00295253 predicted 913
4 SASI_Mm02_00295254 predicted 2527
5 SASI_Mm02_00295255 predicted 1857
6 SASI_Mm02_00295256 predicted 1755
7 SASI_Mm02_00295257 predicted 3316
8 SASI_Mm02_00295258 predicted 3087
9 SASI_Mm02_00295259 predicted 2806
10 SASI_Mm02_00295260 predicted 3054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228121 predicted 486
2 SASI_Mm01_00228122 predicted 2522
3 SASI_Mm01_00228123 predicted 917
4 SASI_Mm01_00228124 predicted 2531
5 SASI_Mm01_00228125 predicted 1757
6 SASI_Mm01_00228126 predicted 366
7 SASI_Mm01_00228127 predicted 3324
8 SASI_Mm01_00228128 predicted 3096
9 SASI_Mm01_00228129 predicted 2815
10 SASI_Mm01_00228130 predicted 3061
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221739 predicted 480
2 SASI_Mm01_00221740 predicted 1553
3 SASI_Mm01_00221741 predicted 2526
4 SASI_Mm01_00221742 predicted 920
5 SASI_Mm01_00221743 predicted 2537
6 SASI_Mm01_00221744 predicted 1759
7 SASI_Mm01_00221745 predicted 972
8 SASI_Mm01_00221746 predicted 360
9 SASI_Mm01_00221747 predicted 3039
10 SASI_Mm01_00221748 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133636
VALIDATED
HELQ MISSION shRNA Bacterial Glycerol Stock
helicase, POLQ-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3279s21c1
Sequence:CCGGAGTCTAATGCACTTAGCTAATCTCGAGATTAGCTAAGTGCATTAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-2486s21c1
Sequence:CCGGTCTTGATGACATCTATCATTTCTCGAGAAATGATAGATGTCATCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3010s21c1
Sequence:CCGGTGCTCAAAGAGACCAACATTTCTCGAGAAATGTTGGTCTCTTTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-714s21c1
Sequence:CCGGGGATATGAAGGTGTCACTATTCTCGAGAATAGTGACACCTTCATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-502s21c1
Sequence:CCGGTTGGTGACTATGATAGCTTTACTCGAGTAAAGCTATCATAGTCACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-2968s21c1
Sequence:CCGGACGTTGTCAACAGGCTATATCCTCGAGGATATAGCCTGTTGACAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3317s21c1
Sequence:CCGGCGTAAGGACAATTGATCATTTCTCGAGAAATGATCAATTGTCCTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-3328s1c1
Sequence:CCGGGCAAATTGTTTCATCAGCAAACTCGAGTTTGCTGATGAAACAATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133636.1-769s1c1
Sequence:CCGGGCAGAACTCTTCAAATGATTTCTCGAGAAATCATTTGAAGAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-1904s1c1
Sequence:CCGGCCTAGTAAGAAGAACTGTGAACTCGAGTTCACAGTTCTTCTTACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-639s1c1
Sequence:CCGGGCAACCTTACTGAATTACAAACTCGAGTTTGTAATTCAGTAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-2800s1c1
Sequence:CCGGCCCTGATTGGATGATATACTTCTCGAGAAGTATATCATCCAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-1659s21c1
Sequence:CCGGATTGGTATGAGTGCAACATTACTCGAGTAATGTTGCACTCATACCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133636
VALIDATED
HELQ MISSION shRNA shRNA Plasmid DNA
helicase, POLQ-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3279s21c1
Sequence:CCGGAGTCTAATGCACTTAGCTAATCTCGAGATTAGCTAAGTGCATTAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-2486s21c1
Sequence:CCGGTCTTGATGACATCTATCATTTCTCGAGAAATGATAGATGTCATCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3010s21c1
Sequence:CCGGTGCTCAAAGAGACCAACATTTCTCGAGAAATGTTGGTCTCTTTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-714s21c1
Sequence:CCGGGGATATGAAGGTGTCACTATTCTCGAGAATAGTGACACCTTCATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-502s21c1
Sequence:CCGGTTGGTGACTATGATAGCTTTACTCGAGTAAAGCTATCATAGTCACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-2968s21c1
Sequence:CCGGACGTTGTCAACAGGCTATATCCTCGAGGATATAGCCTGTTGACAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3317s21c1
Sequence:CCGGCGTAAGGACAATTGATCATTTCTCGAGAAATGATCAATTGTCCTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-3328s1c1
Sequence:CCGGGCAAATTGTTTCATCAGCAAACTCGAGTTTGCTGATGAAACAATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133636.1-769s1c1
Sequence:CCGGGCAGAACTCTTCAAATGATTTCTCGAGAAATCATTTGAAGAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-1904s1c1
Sequence:CCGGCCTAGTAAGAAGAACTGTGAACTCGAGTTCACAGTTCTTCTTACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-639s1c1
Sequence:CCGGGCAACCTTACTGAATTACAAACTCGAGTTTGTAATTCAGTAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-2800s1c1
Sequence:CCGGCCCTGATTGGATGATATACTTCTCGAGAAGTATATCATCCAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-1659s21c1
Sequence:CCGGATTGGTATGAGTGCAACATTACTCGAGTAATGTTGCACTCATACCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133636
VALIDATED
HELQ MISSION shRNA Lentiviral Transduction Particles
helicase, POLQ-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3279s21c1
Sequence:CCGGAGTCTAATGCACTTAGCTAATCTCGAGATTAGCTAAGTGCATTAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-2486s21c1
Sequence:CCGGTCTTGATGACATCTATCATTTCTCGAGAAATGATAGATGTCATCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3010s21c1
Sequence:CCGGTGCTCAAAGAGACCAACATTTCTCGAGAAATGTTGGTCTCTTTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-714s21c1
Sequence:CCGGGGATATGAAGGTGTCACTATTCTCGAGAATAGTGACACCTTCATATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-502s21c1
Sequence:CCGGTTGGTGACTATGATAGCTTTACTCGAGTAAAGCTATCATAGTCACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-2968s21c1
Sequence:CCGGACGTTGTCAACAGGCTATATCCTCGAGGATATAGCCTGTTGACAACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-3317s21c1
Sequence:CCGGCGTAAGGACAATTGATCATTTCTCGAGAAATGATCAATTGTCCTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-3328s1c1
Sequence:CCGGGCAAATTGTTTCATCAGCAAACTCGAGTTTGCTGATGAAACAATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133636.1-769s1c1
Sequence:CCGGGCAGAACTCTTCAAATGATTTCTCGAGAAATCATTTGAAGAGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-1904s1c1
Sequence:CCGGCCTAGTAAGAAGAACTGTGAACTCGAGTTCACAGTTCTTCTTACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-639s1c1
Sequence:CCGGGCAACCTTACTGAATTACAAACTCGAGTTTGTAATTCAGTAAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133636.1-2800s1c1
Sequence:CCGGCCCTGATTGGATGATATACTTCTCGAGAAGTATATCATCCAATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133636.2-1659s21c1
Sequence:CCGGATTGGTATGAGTGCAACATTACTCGAGTAATGTTGCACTCATACCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081107
VALIDATED
HELQ MISSION shRNA Bacterial Glycerol Stock
helicase, POLQ-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000225891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-3464s21c1
Sequence:CCGGCGGACAATGAGTGTCAGAAATCTCGAGATTTCTGACACTCATTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1926s21c1
Sequence:CCGGCCTATCACCACAGCGGTTTAACTCGAGTTAAACCGCTGTGGTGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1646s21c1
Sequence:CCGGTCACGGCTCCTGAGTTATAAGCTCGAGCTTATAACTCAGGAGCCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1305s21c1
Sequence:CCGGATATCGCCACTATCGAGAAAGCTCGAGCTTTCTCGATAGTGGCGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081107
VALIDATED
HELQ MISSION shRNA shRNA Plasmid DNA
helicase, POLQ-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000225891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-3464s21c1
Sequence:CCGGCGGACAATGAGTGTCAGAAATCTCGAGATTTCTGACACTCATTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1926s21c1
Sequence:CCGGCCTATCACCACAGCGGTTTAACTCGAGTTAAACCGCTGTGGTGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1646s21c1
Sequence:CCGGTCACGGCTCCTGAGTTATAAGCTCGAGCTTATAACTCAGGAGCCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1305s21c1
Sequence:CCGGATATCGCCACTATCGAGAAAGCTCGAGCTTTCTCGATAGTGGCGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081107
VALIDATED
HELQ MISSION shRNA Lentiviral Transduction Particles
helicase, POLQ-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000225891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-3464s21c1
Sequence:CCGGCGGACAATGAGTGTCAGAAATCTCGAGATTTCTGACACTCATTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1926s21c1
Sequence:CCGGCCTATCACCACAGCGGTTTAACTCGAGTTAAACCGCTGTGGTGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1646s21c1
Sequence:CCGGTCACGGCTCCTGAGTTATAAGCTCGAGCTTATAACTCAGGAGCCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081107.1-1305s21c1
Sequence:CCGGATATCGCCACTATCGAGAAAGCTCGAGCTTTCTCGATAGTGGCGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)