EMAIL THIS PAGE TO A FRIEND

HELT

helt bHLH transcription factor

51 Gene Product Result for
Synonyms: HCM1228 HESL Mgn bHLHb44
UniProtKB ID: A6NFD8, B2RTS5, B7ZMI8
Gene ID:
Mouse(234219) helt bHLH transcription factor
Rat(498633) helt bHLH transcription factor
Zebrafish(404275) hey-like transcription factor
chicken(101666073) helt bHLH transcription factor
cow(527932) helt bHLH transcription factor
domestic cat(101091103) helt bHLH transcription factor
dog(100683394) helt bHLH transcription factor
chicken(101750337) helt bHLH transcription factor
domestic guinea pig(100728610) helt bHLH transcription factor
naked mole-rat(101705416) helt bHLH transcription factor
sheep(101111517) helt bHLH transcription factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029887 Rosetta Predictions human pricing
XM_001060882 Rosetta Predictions rat pricing
XM_573912 Rosetta Predictions rat pricing
NM_173789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238115 predicted 428
2 SASI_Hs01_00238116 predicted 526
3 SASI_Hs01_00238117 predicted 490
4 SASI_Hs01_00238118 predicted 200
5 SASI_Hs01_00238119 predicted 522
6 SASI_Hs01_00238120 predicted 596
7 SASI_Hs01_00238121 predicted 677
8 SASI_Hs01_00238122 predicted 254
9 SASI_Hs01_00238123 predicted 649
10 SASI_Hs01_00238124 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298035 predicted 944
2 SASI_Rn02_00298036 predicted 1348
3 SASI_Rn02_00298037 predicted 786
4 SASI_Rn02_00298038 predicted 1056
5 SASI_Rn02_00298039 predicted 1133
6 SASI_Rn02_00298040 predicted 1131
7 SASI_Rn02_00298041 predicted 959
8 SASI_Rn02_00298042 predicted 783
9 SASI_Rn02_00298043 predicted 976
10 SASI_Rn02_00298044 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401021 predicted 1464
2 SASI_Rn02_00401022 predicted 1445
3 SASI_Rn02_00401023 predicted 1351
4 SASI_Rn02_00401024 predicted 786
5 SASI_Rn02_00401025 predicted 1502
6 SASI_Rn02_00401026 predicted 1562
7 SASI_Rn02_00401027 predicted 1484
8 SASI_Rn02_00401028 predicted 1592
9 SASI_Rn02_00401029 predicted 959
10 SASI_Rn02_00401030 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038272 predicted 672
2 SASI_Mm01_00038273 predicted 684
3 SASI_Mm01_00038274 predicted 737
4 SASI_Mm01_00038275 predicted 698
5 SASI_Mm01_00038276 predicted 962
6 SASI_Mm01_00038277 predicted 687
7 SASI_Mm01_00038278 predicted 727
8 SASI_Mm02_00345437 predicted 879
9 SASI_Mm01_00038279 predicted 895
10 SASI_Mm01_00038280 predicted 867
11 SASI_Mm01_00038281 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373043
HELT MISSION shRNA Bacterial Glycerol Stock
helt bHLH transcription factor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-184s1c1
Sequence:CCGGCCCGTTTCTCATAAAGTGATACTCGAGTATCACTTTATGAGAAACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-490s1c1
Sequence:CCGGGCAGAACTTCTAGCGGAGTTTCTCGAGAAACTCCGCTAGAAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-507s1c1
Sequence:CCGGGTTTGCCAACTACTTCCACTACTCGAGTAGTGGAAGTAGTTGGCAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-542s1c1
Sequence:CCGGGCATGAAGAACCTGGTGCATTCTCGAGAATGCACCAGGTTCTTCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-615s1c1
Sequence:CCGGCCTCGCCTTCTTGCAGTCCAACTCGAGTTGGACTGCAAGAAGGCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373043
HELT MISSION shRNA shRNA Plasmid DNA
helt bHLH transcription factor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-184s1c1
Sequence:CCGGCCCGTTTCTCATAAAGTGATACTCGAGTATCACTTTATGAGAAACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-490s1c1
Sequence:CCGGGCAGAACTTCTAGCGGAGTTTCTCGAGAAACTCCGCTAGAAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-507s1c1
Sequence:CCGGGTTTGCCAACTACTTCCACTACTCGAGTAGTGGAAGTAGTTGGCAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-542s1c1
Sequence:CCGGGCATGAAGAACCTGGTGCATTCTCGAGAATGCACCAGGTTCTTCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-615s1c1
Sequence:CCGGCCTCGCCTTCTTGCAGTCCAACTCGAGTTGGACTGCAAGAAGGCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373043
HELT MISSION shRNA Lentiviral Transduction Particles
helt bHLH transcription factor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-184s1c1
Sequence:CCGGCCCGTTTCTCATAAAGTGATACTCGAGTATCACTTTATGAGAAACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-490s1c1
Sequence:CCGGGCAGAACTTCTAGCGGAGTTTCTCGAGAAACTCCGCTAGAAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-507s1c1
Sequence:CCGGGTTTGCCAACTACTTCCACTACTCGAGTAGTGGAAGTAGTTGGCAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-542s1c1
Sequence:CCGGGCATGAAGAACCTGGTGCATTCTCGAGAATGCACCAGGTTCTTCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373043.1-615s1c1
Sequence:CCGGCCTCGCCTTCTTGCAGTCCAACTCGAGTTGGACTGCAAGAAGGCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173789
HELT MISSION shRNA Bacterial Glycerol Stock
helt bHLH transcription factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173789.4-1382s1c1
Sequence:CCGGGCGGCTTGAGACGATGTATATCTCGAGATATACATCGTCTCAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-1263s1c1
Sequence:CCGGCCGGCATTATCTCAATCTGATCTCGAGATCAGATTGAGATAATGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-693s1c1
Sequence:CCGGCCGAATTAACCGCTGCTTGAACTCGAGTTCAAGCAGCGGTTAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-870s1c1
Sequence:CCGGCAACTACTTCCACTACGGTTACTCGAGTAACCGTAGTGGAAGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-654s1c1
Sequence:CCGGCCCGGTTTCTCATAAAGTGATCTCGAGATCACTTTATGAGAAACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173789
HELT MISSION shRNA shRNA Plasmid DNA
helt bHLH transcription factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173789.4-1382s1c1
Sequence:CCGGGCGGCTTGAGACGATGTATATCTCGAGATATACATCGTCTCAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-1263s1c1
Sequence:CCGGCCGGCATTATCTCAATCTGATCTCGAGATCAGATTGAGATAATGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-693s1c1
Sequence:CCGGCCGAATTAACCGCTGCTTGAACTCGAGTTCAAGCAGCGGTTAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-870s1c1
Sequence:CCGGCAACTACTTCCACTACGGTTACTCGAGTAACCGTAGTGGAAGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-654s1c1
Sequence:CCGGCCCGGTTTCTCATAAAGTGATCTCGAGATCACTTTATGAGAAACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173789
HELT MISSION shRNA Lentiviral Transduction Particles
helt bHLH transcription factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173789.4-1382s1c1
Sequence:CCGGGCGGCTTGAGACGATGTATATCTCGAGATATACATCGTCTCAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-1263s1c1
Sequence:CCGGCCGGCATTATCTCAATCTGATCTCGAGATCAGATTGAGATAATGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-693s1c1
Sequence:CCGGCCGAATTAACCGCTGCTTGAACTCGAGTTCAAGCAGCGGTTAATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-870s1c1
Sequence:CCGGCAACTACTTCCACTACGGTTACTCGAGTAACCGTAGTGGAAGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173789.4-654s1c1
Sequence:CCGGCCCGGTTTCTCATAAAGTGATCTCGAGATCACTTTATGAGAAACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)