EMAIL THIS PAGE TO A FRIEND

HELZ2

helicase with zinc finger 2, transcriptional coactivator

106 Gene Product Result for
Synonyms: PDIP-1 PRIC285
UniProtKB ID: Q9BYK8, Q3C2G2, Q4VXQ1, Q8TEF3, Q96ND3, Q9C094
Gene ID:
Human(85441) Summary: The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(229003) helicase with zinc finger 2, transcriptional coactivator
Rat(296474) helicase with zinc finger 2, transcriptional coactivator
chicken(419265) helicase with zinc finger 2, transcriptional coactivator
dog(485973) helicase with zinc finger 2, transcriptional coactivator
domestic cat(101099791) helicase with zinc finger 2, transcriptional coactivator
domestic guinea pig(100716599) helicase with zinc finger 2, transcriptional coactivator
naked mole-rat(101722730) helicase with zinc finger 2, transcriptional coactivator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033405 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184751 MISSION® esiRNA esiRNA targeting mouse BC006779 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037335 Rosetta Predictions human pricing
NM_033405 Rosetta Predictions human pricing
XM_001057758 Rosetta Predictions rat pricing
XM_230961 Rosetta Predictions rat pricing
NM_183162 Rosetta Predictions mouse pricing
XM_001003843 Rosetta Predictions mouse pricing
XM_001003848 Rosetta Predictions mouse pricing
XM_001003853 Rosetta Predictions mouse pricing
XM_001003857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101887 predicted 8033
2 SASI_Hs01_00101888 predicted 8159
3 SASI_Hs01_00101889 predicted 7853
4 SASI_Hs01_00101891 predicted 7771
5 SASI_Hs01_00101892 predicted 3142
6 SASI_Hs01_00101893 predicted 7762
7 SASI_Hs01_00101895 predicted 7759
8 SASI_Hs01_00101896 predicted 7000
9 SASI_Hs02_00308285 predicted 6766
10 SASI_Hs02_00308286 predicted 5397
11 SASI_Hs01_00101890 predicted 5471
12 SASI_Hs01_00101894 predicted 5471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042722 predicted 5537
2 SASI_Hs01_00042723 predicted 5661
3 SASI_Hs01_00042724 predicted 5351
4 SASI_Hs01_00042726 predicted 5279
5 SASI_Hs01_00042727 predicted 641
6 SASI_Hs01_00042728 predicted 5268
7 SASI_Hs01_00042730 predicted 5268
8 SASI_Hs01_00042731 predicted 4512
9 SASI_Hs02_00361296 predicted 4272
10 SASI_Hs02_00361297 predicted 2909
11 SASI_Hs01_00042725 predicted 2981
12 SASI_Hs01_00042729 predicted 2982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287469 predicted 5893
2 SASI_Rn02_00287470 predicted 2700
3 SASI_Rn02_00287471 predicted 6368
4 SASI_Rn02_00287472 predicted 383
5 SASI_Rn02_00287473 predicted 1172
6 SASI_Rn02_00287474 predicted 283
7 SASI_Rn02_00287475 predicted 2611
8 SASI_Rn02_00287476 predicted 5430
9 SASI_Rn02_00287477 predicted 707
10 SASI_Rn02_00287478 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386592 predicted 5889
2 SASI_Rn02_00386593 predicted 2705
3 SASI_Rn02_00386594 predicted 6372
4 SASI_Rn02_00386595 predicted 390
5 SASI_Rn02_00386596 predicted 1170
6 SASI_Rn02_00386597 predicted 287
7 SASI_Rn02_00386598 predicted 2616
8 SASI_Rn02_00386599 predicted 5435
9 SASI_Rn02_00386600 predicted 703
10 SASI_Rn02_00386601 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350225 predicted 703
2 SASI_Mm02_00350226 predicted 2921
3 SASI_Mm02_00350227 predicted 8386
4 SASI_Mm02_00350228 predicted 7340
5 SASI_Mm02_00350229 predicted 2399
6 SASI_Mm02_00350230 predicted 2290
7 SASI_Mm02_00350231 predicted 5162
8 SASI_Mm02_00350232 predicted 6710
9 SASI_Mm02_00350233 predicted 5341
10 SASI_Mm02_00350234 predicted 4430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277963 predicted 712
2 SASI_Mm01_00277964 predicted 781
3 SASI_Mm01_00277965 predicted 786
4 SASI_Mm01_00277966 predicted 2454
5 SASI_Mm01_00277967 predicted 2096
6 SASI_Mm01_00277968 predicted 272
7 SASI_Mm01_00277969 predicted 2410
8 SASI_Mm01_00277970 predicted 2297
9 SASI_Mm01_00277971 predicted 212
10 SASI_Mm01_00277972 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218701 predicted 8559
2 SASI_Mm01_00218702 predicted 8641
3 SASI_Mm01_00218703 predicted 9422
4 SASI_Mm01_00218704 predicted 8613
5 SASI_Mm01_00218705 predicted 8472
6 SASI_Mm01_00218706 predicted 9171
7 SASI_Mm01_00218707 predicted 9307
8 SASI_Mm01_00218708 predicted 9397
9 SASI_Mm01_00218709 predicted 9428
10 SASI_Mm01_00218710 predicted 9348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231639 predicted 1545
2 SASI_Mm01_00231640 predicted 1636
3 SASI_Mm01_00231641 predicted 2416
4 SASI_Mm01_00231642 predicted 1602
5 SASI_Mm01_00231643 predicted 1469
6 SASI_Mm01_00231644 predicted 2161
7 SASI_Mm01_00231645 predicted 2295
8 SASI_Mm01_00231646 predicted 2388
9 SASI_Mm01_00231647 predicted 2413
10 SASI_Mm01_00231648 predicted 2342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253032 predicted 8444
2 SASI_Mm01_00253033 predicted 8530
3 SASI_Mm01_00253034 predicted 9310
4 SASI_Mm01_00253035 predicted 8496
5 SASI_Mm01_00253036 predicted 8364
6 SASI_Mm01_00253037 predicted 9060
7 SASI_Mm01_00253038 predicted 9185
8 SASI_Mm01_00253039 predicted 9285
9 SASI_Mm01_00253040 predicted 9314
10 SASI_Mm01_00253041 predicted 9242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183162
VALIDATED
HELZ2 MISSION shRNA Bacterial Glycerol Stock
helicase with zinc finger 2, transcriptional coactivator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183162.2-398s21c1
Sequence:CCGGATCAAGTCTGTCACTACTATACTCGAGTATAGTAGTGACAGACTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183162.2-732s21c1
Sequence:CCGGTGAGGGCCTAAAGCGACAATTCTCGAGAATTGTCGCTTTAGGCCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183162.2-2612s21c1
Sequence:CCGGACATCTATATCCGGGAGTATTCTCGAGAATACTCCCGGATATAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183162.2-8523s21c1
Sequence:CCGGACAGGTGGTCCGCATCATAAACTCGAGTTTATGATGCGGACCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183162.2-9192s21c1
Sequence:CCGGTGCTGGAAGCAGGCTTAATAACTCGAGTTATTAAGCCTGCTTCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183162
VALIDATED
HELZ2 MISSION shRNA shRNA Plasmid DNA
helicase with zinc finger 2, transcriptional coactivator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183162.2-398s21c1
Sequence:CCGGATCAAGTCTGTCACTACTATACTCGAGTATAGTAGTGACAGACTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183162.2-732s21c1
Sequence:CCGGTGAGGGCCTAAAGCGACAATTCTCGAGAATTGTCGCTTTAGGCCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183162.2-2612s21c1
Sequence:CCGGACATCTATATCCGGGAGTATTCTCGAGAATACTCCCGGATATAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183162.2-8523s21c1
Sequence:CCGGACAGGTGGTCCGCATCATAAACTCGAGTTTATGATGCGGACCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183162.2-9192s21c1
Sequence:CCGGTGCTGGAAGCAGGCTTAATAACTCGAGTTATTAAGCCTGCTTCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183162
VALIDATED
HELZ2 MISSION shRNA Lentiviral Transduction Particles
helicase with zinc finger 2, transcriptional coactivator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183162.2-398s21c1
Sequence:CCGGATCAAGTCTGTCACTACTATACTCGAGTATAGTAGTGACAGACTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183162.2-732s21c1
Sequence:CCGGTGAGGGCCTAAAGCGACAATTCTCGAGAATTGTCGCTTTAGGCCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183162.2-2612s21c1
Sequence:CCGGACATCTATATCCGGGAGTATTCTCGAGAATACTCCCGGATATAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183162.2-8523s21c1
Sequence:CCGGACAGGTGGTCCGCATCATAAACTCGAGTTTATGATGCGGACCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183162.2-9192s21c1
Sequence:CCGGTGCTGGAAGCAGGCTTAATAACTCGAGTTATTAAGCCTGCTTCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033405
VALIDATED
HELZ2 MISSION shRNA Bacterial Glycerol Stock
helicase with zinc finger 2, transcriptional coactivator
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000060943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-6680s1c1
Sequence:CCGGCCACCTGTAATCACTCTGGATCTCGAGATCCAGAGTGATTACAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-135s1c1
Sequence:CCGGGACATCTACATCCGGGAGTATCTCGAGATACTCCCGGATGTAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-5273s1c1
Sequence:CCGGCCCTTACTCGTCGGAAATCAACTCGAGTTGATTTCCGACGAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033405.2-4953s1c1
Sequence:CCGGCACATCGTATTCTGGTTTCATCTCGAGATGAAACCAGAATACGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033405
VALIDATED
HELZ2 MISSION shRNA shRNA Plasmid DNA
helicase with zinc finger 2, transcriptional coactivator
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000060943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-6680s1c1
Sequence:CCGGCCACCTGTAATCACTCTGGATCTCGAGATCCAGAGTGATTACAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-135s1c1
Sequence:CCGGGACATCTACATCCGGGAGTATCTCGAGATACTCCCGGATGTAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-5273s1c1
Sequence:CCGGCCCTTACTCGTCGGAAATCAACTCGAGTTGATTTCCGACGAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033405.2-4953s1c1
Sequence:CCGGCACATCGTATTCTGGTTTCATCTCGAGATGAAACCAGAATACGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033405
VALIDATED
HELZ2 MISSION shRNA Lentiviral Transduction Particles
helicase with zinc finger 2, transcriptional coactivator
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000060943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-6680s1c1
Sequence:CCGGCCACCTGTAATCACTCTGGATCTCGAGATCCAGAGTGATTACAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-135s1c1
Sequence:CCGGGACATCTACATCCGGGAGTATCTCGAGATACTCCCGGATGTAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033405.2-5273s1c1
Sequence:CCGGCCCTTACTCGTCGGAAATCAACTCGAGTTGATTTCCGACGAGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033405.2-4953s1c1
Sequence:CCGGCACATCGTATTCTGGTTTCATCTCGAGATGAAACCAGAATACGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)