EMAIL THIS PAGE TO A FRIEND

HELZ

helicase with zinc finger

79 Gene Product Result for
Synonyms: DHRC DRHC HUMORF5
UniProtKB ID: P42694
Gene ID:
Human(9931) Summary: HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]
Mouse(78455) helicase with zinc finger domain
Rat(287773) helicase with zinc finger
sheep(101117777) helicase with zinc finger
Domestic Rabbit(100338520) helicase with zinc finger
domestic guinea pig(100713077) helicase with zinc finger
naked mole-rat(101699823) helicase with zinc finger
Zebrafish(406550) helicase with zinc finger
chicken(417427) helicase with zinc finger
domestic cat(101101269) helicase with zinc finger
cow(539501) helicase with zinc finger
Horse(100053580) helicase with zinc finger
dog(490907) helicase with zinc finger
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014877 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_126554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014877 Rosetta Predictions human pricing
NM_001105848 Rosetta Predictions rat pricing
NM_198298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217879 predicted 2758
2 SASI_Hs01_00217880 predicted 2786
3 SASI_Hs01_00217881 predicted 1543
4 SASI_Hs01_00217883 predicted 1503
5 SASI_Hs02_00346486 predicted 4361
6 SASI_Hs01_00217884 predicted 1207
7 SASI_Hs02_00346487 predicted 1125
8 SASI_Hs01_00217887 predicted 3301
9 SASI_Hs02_00346488 predicted 2001
10 SASI_Hs01_00217888 predicted 3780
11 SASI_Hs01_00217882 predicted 1378
12 SASI_Hs01_00217885 predicted 2687
13 SASI_Hs01_00217886 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213122 predicted 1393
2 SASI_Rn02_00213123 predicted 1716
3 SASI_Rn02_00213124 predicted 3532
4 SASI_Rn02_00213125 predicted 4326
5 SASI_Rn02_00213126 predicted 2682
6 SASI_Rn02_00213127 predicted 1012
7 SASI_Rn02_00213128 predicted 1886
8 SASI_Rn02_00213129 predicted 2625
9 SASI_Rn02_00213130 predicted 3636
10 SASI_Rn02_00213131 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074952 predicted 1733
2 SASI_Mm01_00074953 predicted 3844
3 SASI_Mm01_00074954 predicted 3553
4 SASI_Mm01_00074955 predicted 3662
5 SASI_Mm02_00350928 predicted 4349
6 SASI_Mm01_00074956 predicted 1317
7 SASI_Mm01_00074958 predicted 1116
8 SASI_Mm01_00074959 predicted 5776
9 SASI_Mm02_00350929 predicted 1629
10 SASI_Mm01_00074960 predicted 1037
11 SASI_Mm01_00074957 predicted 2720
12 SASI_Mm01_00074961 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014877
VALIDATED
HELZ MISSION shRNA Bacterial Glycerol Stock
helicase with zinc finger
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-1553s1c1
Sequence:CCGGCACGGTTACATGACCTTCTTTCTCGAGAAAGAAGGTCATGTAACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-925s1c1
Sequence:CCGGCCTGAGAAAGTGCTTAGTGAACTCGAGTTCACTAAGCACTTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014877.2-2450s1c1
Sequence:CCGGCCCAGAAAGAAGATATTCTTACTCGAGTAAGAATATCTTCTTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-714s1c1
Sequence:CCGGCGAGGAATATACTTTGTGTAACTCGAGTTACACAAAGTATATTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014877.2-1766s1c1
Sequence:CCGGCCAAAGTCAATGCTGTTTATTCTCGAGAATAAACAGCATTGACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014877.2-6091s1c1
Sequence:CCGGGATGCACAGTTCCCTTTGTTTCTCGAGAAACAAAGGGAACTGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014877.2-6144s1c1
Sequence:CCGGGCTGCTAGACTTGCAACTAATCTCGAGATTAGTTGCAAGTCTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014877
VALIDATED
HELZ MISSION shRNA shRNA Plasmid DNA
helicase with zinc finger
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-1553s1c1
Sequence:CCGGCACGGTTACATGACCTTCTTTCTCGAGAAAGAAGGTCATGTAACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-925s1c1
Sequence:CCGGCCTGAGAAAGTGCTTAGTGAACTCGAGTTCACTAAGCACTTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014877.2-2450s1c1
Sequence:CCGGCCCAGAAAGAAGATATTCTTACTCGAGTAAGAATATCTTCTTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-714s1c1
Sequence:CCGGCGAGGAATATACTTTGTGTAACTCGAGTTACACAAAGTATATTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014877.2-1766s1c1
Sequence:CCGGCCAAAGTCAATGCTGTTTATTCTCGAGAATAAACAGCATTGACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014877.2-6091s1c1
Sequence:CCGGGATGCACAGTTCCCTTTGTTTCTCGAGAAACAAAGGGAACTGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014877.2-6144s1c1
Sequence:CCGGGCTGCTAGACTTGCAACTAATCTCGAGATTAGTTGCAAGTCTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014877
VALIDATED
HELZ MISSION shRNA Lentiviral Transduction Particles
helicase with zinc finger
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-1553s1c1
Sequence:CCGGCACGGTTACATGACCTTCTTTCTCGAGAAAGAAGGTCATGTAACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-925s1c1
Sequence:CCGGCCTGAGAAAGTGCTTAGTGAACTCGAGTTCACTAAGCACTTTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014877.2-2450s1c1
Sequence:CCGGCCCAGAAAGAAGATATTCTTACTCGAGTAAGAATATCTTCTTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014877.2-714s1c1
Sequence:CCGGCGAGGAATATACTTTGTGTAACTCGAGTTACACAAAGTATATTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014877.2-1766s1c1
Sequence:CCGGCCAAAGTCAATGCTGTTTATTCTCGAGAATAAACAGCATTGACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014877.2-6091s1c1
Sequence:CCGGGATGCACAGTTCCCTTTGTTTCTCGAGAAACAAAGGGAACTGTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014877.2-6144s1c1
Sequence:CCGGGCTGCTAGACTTGCAACTAATCTCGAGATTAGTTGCAAGTCTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126554
VALIDATED
HELZ MISSION shRNA Bacterial Glycerol Stock
helicase with zinc finger
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126554.5-3633s1c1
Sequence:CCGGCGTACTTATTGGCAATCCTATCTCGAGATAGGATTGCCAATAAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-1441s1c1
Sequence:CCGGCTGCTTTATATTGAGGAGATACTCGAGTATCTCCTCAATATAAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-3237s1c1
Sequence:CCGGCGAGGACTTAGATTATGGTTTCTCGAGAAACCATAATCTAAGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-2164s1c1
Sequence:CCGGGACCTCTACATAAAGGATTATCTCGAGATAATCCTTTATGTAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-3877s1c1
Sequence:CCGGGCCTACAATATGAACCTATTACTCGAGTAATAGGTTCATATTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126554
VALIDATED
HELZ MISSION shRNA shRNA Plasmid DNA
helicase with zinc finger
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126554.5-3633s1c1
Sequence:CCGGCGTACTTATTGGCAATCCTATCTCGAGATAGGATTGCCAATAAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-1441s1c1
Sequence:CCGGCTGCTTTATATTGAGGAGATACTCGAGTATCTCCTCAATATAAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-3237s1c1
Sequence:CCGGCGAGGACTTAGATTATGGTTTCTCGAGAAACCATAATCTAAGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-2164s1c1
Sequence:CCGGGACCTCTACATAAAGGATTATCTCGAGATAATCCTTTATGTAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-3877s1c1
Sequence:CCGGGCCTACAATATGAACCTATTACTCGAGTAATAGGTTCATATTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126554
VALIDATED
HELZ MISSION shRNA Lentiviral Transduction Particles
helicase with zinc finger
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126554.5-3633s1c1
Sequence:CCGGCGTACTTATTGGCAATCCTATCTCGAGATAGGATTGCCAATAAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-1441s1c1
Sequence:CCGGCTGCTTTATATTGAGGAGATACTCGAGTATCTCCTCAATATAAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-3237s1c1
Sequence:CCGGCGAGGACTTAGATTATGGTTTCTCGAGAAACCATAATCTAAGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-2164s1c1
Sequence:CCGGGACCTCTACATAAAGGATTATCTCGAGATAATCCTTTATGTAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126554.5-3877s1c1
Sequence:CCGGGCCTACAATATGAACCTATTACTCGAGTAATAGGTTCATATTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198298
VALIDATED
HELZ MISSION shRNA Bacterial Glycerol Stock
helicase with zinc finger
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-3555s21c1
Sequence:CCGGCGTACTTATTGGCAATCCTATCTCGAGATAGGATTGCCAATAAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-2211s21c1
Sequence:CCGGCCTCTACATAAAGGATTATTTCTCGAGAAATAATCCTTTATGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-3108s21c1
Sequence:CCGGGCACAAGCAGACGCCAATTAACTCGAGTTAATTGGCGTCTGCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-2789s21c1
Sequence:CCGGTCTATCCACTCACGTTCTTTACTCGAGTAAAGAACGTGAGTGGATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-6070s21c1
Sequence:CCGGTGCAGCCCTCCATTACGTTCACTCGAGTGAACGTAATGGAGGGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198298
VALIDATED
HELZ MISSION shRNA shRNA Plasmid DNA
helicase with zinc finger
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-3555s21c1
Sequence:CCGGCGTACTTATTGGCAATCCTATCTCGAGATAGGATTGCCAATAAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-2211s21c1
Sequence:CCGGCCTCTACATAAAGGATTATTTCTCGAGAAATAATCCTTTATGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-3108s21c1
Sequence:CCGGGCACAAGCAGACGCCAATTAACTCGAGTTAATTGGCGTCTGCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-2789s21c1
Sequence:CCGGTCTATCCACTCACGTTCTTTACTCGAGTAAAGAACGTGAGTGGATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-6070s21c1
Sequence:CCGGTGCAGCCCTCCATTACGTTCACTCGAGTGAACGTAATGGAGGGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198298
VALIDATED
HELZ MISSION shRNA Lentiviral Transduction Particles
helicase with zinc finger
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-3555s21c1
Sequence:CCGGCGTACTTATTGGCAATCCTATCTCGAGATAGGATTGCCAATAAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-2211s21c1
Sequence:CCGGCCTCTACATAAAGGATTATTTCTCGAGAAATAATCCTTTATGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-3108s21c1
Sequence:CCGGGCACAAGCAGACGCCAATTAACTCGAGTTAATTGGCGTCTGCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-2789s21c1
Sequence:CCGGTCTATCCACTCACGTTCTTTACTCGAGTAAAGAACGTGAGTGGATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198298.1-6070s21c1
Sequence:CCGGTGCAGCCCTCCATTACGTTCACTCGAGTGAACGTAATGGAGGGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)