EMAIL THIS PAGE TO A FRIEND

HEMGN

hemogen

66 Gene Product Result for
Synonyms: EDAG EDAG-1
UniProtKB ID: Q9BXL5, Q6XAR3, Q86XY5, Q9NPC0
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_197978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_197978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018437 Rosetta Predictions human pricing
NM_197978 Rosetta Predictions human pricing
NM_133294 Rosetta Predictions rat pricing
NM_053149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156180 predicted 1472
2 SASI_Hs01_00156181 predicted 1050
3 SASI_Hs01_00156182 predicted 1300
4 SASI_Hs01_00156183 predicted 935
5 SASI_Hs02_00351965 predicted 908
6 SASI_Hs01_00156186 predicted 723
7 SASI_Hs01_00156187 predicted 429
8 SASI_Hs01_00156188 predicted 1353
9 SASI_Hs02_00351966 predicted 287
10 SASI_Hs01_00156184 predicted 286
11 SASI_Hs01_00156185 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052649 predicted 1431
2 SASI_Hs01_00052650 predicted 1024
3 SASI_Hs01_00052651 predicted 1270
4 SASI_Hs01_00052652 predicted 898
5 SASI_Hs02_00371594 predicted 873
6 SASI_Hs01_00052655 predicted 696
7 SASI_Hs01_00052656 predicted 398
8 SASI_Hs01_00052657 predicted 1320
9 SASI_Hs02_00371595 predicted 255
10 SASI_Hs01_00052653 predicted 257
11 SASI_Hs01_00052654 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267577 predicted 759
2 SASI_Rn01_00036863 predicted 691
3 SASI_Rn01_00036864 predicted 1236
4 SASI_Rn01_00036866 predicted 589
5 SASI_Rn01_00036867 predicted 632
6 SASI_Rn02_00267578 predicted 601
7 SASI_Rn01_00036868 predicted 429
8 SASI_Rn01_00036869 predicted 619
9 SASI_Rn01_00036870 predicted 271
10 SASI_Rn01_00036871 predicted 616
11 SASI_Rn01_00036865 predicted 1391
12 SASI_Rn01_00036872 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126609 predicted 1435
2 SASI_Mm01_00126610 predicted 1365
3 SASI_Mm01_00126611 predicted 1385
4 SASI_Mm01_00126612 predicted 601
5 SASI_Mm01_00126613 predicted 1268
6 SASI_Mm01_00126614 predicted 728
7 SASI_Mm01_00126615 predicted 976
8 SASI_Mm01_00126617 predicted 1007
9 SASI_Mm01_00126618 predicted 343
10 SASI_Mm02_00337675 predicted 1211
11 SASI_Mm01_00126616 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197978
HEMGN MISSION shRNA Bacterial Glycerol Stock
hemogen
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-1507s1c1
Sequence:CCGGGCAATTCTGAATGAGAGTCATCTCGAGATGACTCTCATTCAGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197978.1-1589s1c1
Sequence:CCGGCCAATGGAACATACAGCTTAACTCGAGTTAAGCTGTATGTTCCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-1417s1c1
Sequence:CCGGGATCCTAAAGCACACCAGGAACTCGAGTTCCTGGTGTGCTTTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-901s1c1
Sequence:CCGGGATGTGCCTAAAGGCTATATTCTCGAGAATATAGCCTTTAGGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-169s1c1
Sequence:CCGGGAAGAGAACCATTCTCCAGAACTCGAGTTCTGGAGAATGGTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-1561s21c1
Sequence:CCGGTAACAATGCTCAACCATAAAGCTCGAGCTTTATGGTTGAGCATTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-1056s21c1
Sequence:CCGGAGAATCAGCTGAACCTAAATACTCGAGTATTTAGGTTCAGCTGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-760s21c1
Sequence:CCGGATGTACCAAGATATGGCTAAACTCGAGTTTAGCCATATCTTGGTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197978.1-1876s21c1
Sequence:CCGGTTACGTCTTAAGAGCAGATAACTCGAGTTATCTGCTCTTAAGACGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197978
HEMGN MISSION shRNA shRNA Plasmid DNA
hemogen
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-1507s1c1
Sequence:CCGGGCAATTCTGAATGAGAGTCATCTCGAGATGACTCTCATTCAGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197978.1-1589s1c1
Sequence:CCGGCCAATGGAACATACAGCTTAACTCGAGTTAAGCTGTATGTTCCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-1417s1c1
Sequence:CCGGGATCCTAAAGCACACCAGGAACTCGAGTTCCTGGTGTGCTTTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-901s1c1
Sequence:CCGGGATGTGCCTAAAGGCTATATTCTCGAGAATATAGCCTTTAGGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-169s1c1
Sequence:CCGGGAAGAGAACCATTCTCCAGAACTCGAGTTCTGGAGAATGGTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-1561s21c1
Sequence:CCGGTAACAATGCTCAACCATAAAGCTCGAGCTTTATGGTTGAGCATTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-1056s21c1
Sequence:CCGGAGAATCAGCTGAACCTAAATACTCGAGTATTTAGGTTCAGCTGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-760s21c1
Sequence:CCGGATGTACCAAGATATGGCTAAACTCGAGTTTAGCCATATCTTGGTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197978.1-1876s21c1
Sequence:CCGGTTACGTCTTAAGAGCAGATAACTCGAGTTATCTGCTCTTAAGACGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197978
HEMGN MISSION shRNA Lentiviral Transduction Particles
hemogen
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-1507s1c1
Sequence:CCGGGCAATTCTGAATGAGAGTCATCTCGAGATGACTCTCATTCAGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197978.1-1589s1c1
Sequence:CCGGCCAATGGAACATACAGCTTAACTCGAGTTAAGCTGTATGTTCCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-1417s1c1
Sequence:CCGGGATCCTAAAGCACACCAGGAACTCGAGTTCCTGGTGTGCTTTAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-901s1c1
Sequence:CCGGGATGTGCCTAAAGGCTATATTCTCGAGAATATAGCCTTTAGGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197978.1-169s1c1
Sequence:CCGGGAAGAGAACCATTCTCCAGAACTCGAGTTCTGGAGAATGGTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-1561s21c1
Sequence:CCGGTAACAATGCTCAACCATAAAGCTCGAGCTTTATGGTTGAGCATTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-1056s21c1
Sequence:CCGGAGAATCAGCTGAACCTAAATACTCGAGTATTTAGGTTCAGCTGATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197978.1-760s21c1
Sequence:CCGGATGTACCAAGATATGGCTAAACTCGAGTTTAGCCATATCTTGGTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197978.1-1876s21c1
Sequence:CCGGTTACGTCTTAAGAGCAGATAACTCGAGTTATCTGCTCTTAAGACGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053149
HEMGN MISSION shRNA Bacterial Glycerol Stock
hemogen
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053149.1-1259s1c1
Sequence:CCGGCAAGAAGCAGTTGAACCTGAACTCGAGTTCAGGTTCAACTGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-941s1c1
Sequence:CCGGCCTCAAGAACATACTTTGAAACTCGAGTTTCAAAGTATGTTCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1359s1c1
Sequence:CCGGCTGAACAATATTCACCTGAAACTCGAGTTTCAGGTGAATATTGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1566s1c1
Sequence:CCGGCTGGTGCTTTCTCTCAAGATTCTCGAGAATCTTGAGAGAAAGCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-689s1c1
Sequence:CCGGGTACTTCAACATTCTCCTAAACTCGAGTTTAGGAGAATGTTGAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1187s1c1
Sequence:CCGGGCTGTGACTGAAGGCTTCTTTCTCGAGAAAGAAGCCTTCAGTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053149
HEMGN MISSION shRNA shRNA Plasmid DNA
hemogen
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053149.1-1259s1c1
Sequence:CCGGCAAGAAGCAGTTGAACCTGAACTCGAGTTCAGGTTCAACTGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-941s1c1
Sequence:CCGGCCTCAAGAACATACTTTGAAACTCGAGTTTCAAAGTATGTTCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1359s1c1
Sequence:CCGGCTGAACAATATTCACCTGAAACTCGAGTTTCAGGTGAATATTGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1566s1c1
Sequence:CCGGCTGGTGCTTTCTCTCAAGATTCTCGAGAATCTTGAGAGAAAGCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-689s1c1
Sequence:CCGGGTACTTCAACATTCTCCTAAACTCGAGTTTAGGAGAATGTTGAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1187s1c1
Sequence:CCGGGCTGTGACTGAAGGCTTCTTTCTCGAGAAAGAAGCCTTCAGTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053149
HEMGN MISSION shRNA Lentiviral Transduction Particles
hemogen
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053149.1-1259s1c1
Sequence:CCGGCAAGAAGCAGTTGAACCTGAACTCGAGTTCAGGTTCAACTGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-941s1c1
Sequence:CCGGCCTCAAGAACATACTTTGAAACTCGAGTTTCAAAGTATGTTCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1359s1c1
Sequence:CCGGCTGAACAATATTCACCTGAAACTCGAGTTTCAGGTGAATATTGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1566s1c1
Sequence:CCGGCTGGTGCTTTCTCTCAAGATTCTCGAGAATCTTGAGAGAAAGCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-689s1c1
Sequence:CCGGGTACTTCAACATTCTCCTAAACTCGAGTTTAGGAGAATGTTGAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053149.1-1187s1c1
Sequence:CCGGGCTGTGACTGAAGGCTTCTTTCTCGAGAAAGAAGCCTTCAGTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)