EMAIL THIS PAGE TO A FRIEND

HEMK1

HemK methyltransferase family member 1

230 Gene Product Result for
Synonyms: HEMK MTQ1
UniProtKB ID: Q9Y5R4
Gene ID:
Mouse(69536) HemK methyltransferase family member 1
Rat(300989) HemK methyltransferase family member 1
domestic guinea pig(100719072) HemK methyltransferase family member 1
naked mole-rat(101712874) HemK methyltransferase family member 1
sheep(101114910) HemK methyltransferase family member 1
Zebrafish(560620) HemK methyltransferase family member 1
dog(476613) HemK methyltransferase family member 1
cow(515459) HemK methyltransferase family member 1
domestic cat(101090174) HemK methyltransferase family member 1
chicken(415915) HemK methyltransferase family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016173 Rosetta Predictions human pricing
NM_001106853 Rosetta Predictions rat pricing
NM_133984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196591 predicted 468
2 SASI_Hs01_00196592 predicted 1135
3 SASI_Hs01_00196593 predicted 461
4 SASI_Hs01_00196594 predicted 1513
5 SASI_Hs01_00196595 predicted 819
6 SASI_Hs01_00196596 predicted 381
7 SASI_Hs01_00196597 predicted 1020
8 SASI_Hs01_00196599 predicted 1532
9 SASI_Hs01_00196600 predicted 1357
10 SASI_Hs02_00348986 predicted 842
11 SASI_Hs01_00196598 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223046 predicted 593
2 SASI_Rn02_00223047 predicted 428
3 SASI_Rn02_00223048 predicted 821
4 SASI_Rn02_00223049 predicted 681
5 SASI_Rn02_00223050 predicted 744
6 SASI_Rn02_00223051 predicted 771
7 SASI_Rn02_00223052 predicted 816
8 SASI_Rn02_00223053 predicted 901
9 SASI_Rn02_00223054 predicted 721
10 SASI_Rn02_00223055 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048033 predicted 579
2 SASI_Mm01_00048035 predicted 743
3 SASI_Mm01_00048036 predicted 1231
4 SASI_Mm01_00048037 predicted 1091
5 SASI_Mm01_00048038 predicted 915
6 SASI_Mm02_00339113 predicted 311
7 SASI_Mm01_00048039 predicted 878
8 SASI_Mm01_00048040 predicted 730
9 SASI_Mm01_00048041 predicted 947
10 SASI_Mm01_00048042 predicted 450
11 SASI_Mm01_00048034 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016173
VALIDATED
HEMK1 MISSION shRNA Bacterial Glycerol Stock
HemK methyltransferase family member 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-570s21c1
Sequence:CCGGTGAGTAGCCGTCGATTGCAGACTCGAGTCTGCAATCGACGGCTACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1750s21c1
Sequence:CCGGCTCACTCCCAGGGATTGATTACTCGAGTAATCAATCCCTGGGAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-536s21c1
Sequence:CCGGTTGACCTCTCAGCAACTACAGCTCGAGCTGTAGTTGCTGAGAGGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1528s21c1
Sequence:CCGGAGTATTGAGAGACTAACAAATCTCGAGATTTGTTAGTCTCTCAATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-968s21c1
Sequence:CCGGATGGACCTGATTGTCAGCAACCTCGAGGTTGCTGACAATCAGGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-593s21c1
Sequence:CCGGATGCCGGTGCAGTACATCCTTCTCGAGAAGGATGTACTGCACCGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-917s21c1
Sequence:CCGGCACCTCGACATGACCTCAGAACTCGAGTTCTGAGGTCATGTCGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1407s21c1
Sequence:CCGGCTCTGCATTTCTAGGATATTTCTCGAGAAATATCCTAGAAATGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016173.1-387s1c1
Sequence:CCGGAGTGAGTACATCGTGGCTCATCTCGAGATGAGCCACGATGTACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-821s1c1
Sequence:CCGGGCAGGACAGGATTTGGATCATCTCGAGATGATCCAAATCCTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-1128s1c1
Sequence:CCGGCCTGACCTGTACCTTAATCTTCTCGAGAAGATTAAGGTACAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016173.1-1069s1c1
Sequence:CCGGTCTTCTTAGAAGTGGACCCAACTCGAGTTGGGTCCACTTCTAAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-600s1c1
Sequence:CCGGCCAGAAACAGAGGAACTGGTTCTCGAGAACCAGTTCCTCTGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016173
VALIDATED
HEMK1 MISSION shRNA shRNA Plasmid DNA
HemK methyltransferase family member 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-570s21c1
Sequence:CCGGTGAGTAGCCGTCGATTGCAGACTCGAGTCTGCAATCGACGGCTACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1750s21c1
Sequence:CCGGCTCACTCCCAGGGATTGATTACTCGAGTAATCAATCCCTGGGAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-536s21c1
Sequence:CCGGTTGACCTCTCAGCAACTACAGCTCGAGCTGTAGTTGCTGAGAGGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1528s21c1
Sequence:CCGGAGTATTGAGAGACTAACAAATCTCGAGATTTGTTAGTCTCTCAATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-968s21c1
Sequence:CCGGATGGACCTGATTGTCAGCAACCTCGAGGTTGCTGACAATCAGGTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-593s21c1
Sequence:CCGGATGCCGGTGCAGTACATCCTTCTCGAGAAGGATGTACTGCACCGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-917s21c1
Sequence:CCGGCACCTCGACATGACCTCAGAACTCGAGTTCTGAGGTCATGTCGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1407s21c1
Sequence:CCGGCTCTGCATTTCTAGGATATTTCTCGAGAAATATCCTAGAAATGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016173.1-387s1c1
Sequence:CCGGAGTGAGTACATCGTGGCTCATCTCGAGATGAGCCACGATGTACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-821s1c1
Sequence:CCGGGCAGGACAGGATTTGGATCATCTCGAGATGATCCAAATCCTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-1128s1c1
Sequence:CCGGCCTGACCTGTACCTTAATCTTCTCGAGAAGATTAAGGTACAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016173.1-1069s1c1
Sequence:CCGGTCTTCTTAGAAGTGGACCCAACTCGAGTTGGGTCCACTTCTAAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-600s1c1
Sequence:CCGGCCAGAAACAGAGGAACTGGTTCTCGAGAACCAGTTCCTCTGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016173
VALIDATED
HEMK1 MISSION shRNA Lentiviral Transduction Particles
HemK methyltransferase family member 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-570s21c1
Sequence:CCGGTGAGTAGCCGTCGATTGCAGACTCGAGTCTGCAATCGACGGCTACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1750s21c1
Sequence:CCGGCTCACTCCCAGGGATTGATTACTCGAGTAATCAATCCCTGGGAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-536s21c1
Sequence:CCGGTTGACCTCTCAGCAACTACAGCTCGAGCTGTAGTTGCTGAGAGGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1528s21c1
Sequence:CCGGAGTATTGAGAGACTAACAAATCTCGAGATTTGTTAGTCTCTCAATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-968s21c1
Sequence:CCGGATGGACCTGATTGTCAGCAACCTCGAGGTTGCTGACAATCAGGTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-593s21c1
Sequence:CCGGATGCCGGTGCAGTACATCCTTCTCGAGAAGGATGTACTGCACCGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016173.3-917s21c1
Sequence:CCGGCACCTCGACATGACCTCAGAACTCGAGTTCTGAGGTCATGTCGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016173.3-1407s21c1
Sequence:CCGGCTCTGCATTTCTAGGATATTTCTCGAGAAATATCCTAGAAATGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016173.1-387s1c1
Sequence:CCGGAGTGAGTACATCGTGGCTCATCTCGAGATGAGCCACGATGTACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-821s1c1
Sequence:CCGGGCAGGACAGGATTTGGATCATCTCGAGATGATCCAAATCCTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-1128s1c1
Sequence:CCGGCCTGACCTGTACCTTAATCTTCTCGAGAAGATTAAGGTACAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016173.1-1069s1c1
Sequence:CCGGTCTTCTTAGAAGTGGACCCAACTCGAGTTGGGTCCACTTCTAAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_016173.1-600s1c1
Sequence:CCGGCCAGAAACAGAGGAACTGGTTCTCGAGAACCAGTTCCTCTGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133984
VALIDATED
HEMK1 MISSION shRNA Bacterial Glycerol Stock
HemK methyltransferase family member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-978s1c1
Sequence:CCGGCATGGACATCATCACCCACATCTCGAGATGTGGGTGATGATGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133984.1-1376s1c1
Sequence:CCGGCAGCAAAGAACAGAGACCCAACTCGAGTTGGGTCTCTGTTCTTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-801s1c1
Sequence:CCGGCCGGATCATCTGCCTTGATATCTCGAGATATCAAGGCAGATGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-1027s1c1
Sequence:CCGGGCCTCTGGAAGCATCTTCTTACTCGAGTAAGAAGATGCTTCCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-435s1c1
Sequence:CCGGCCCTCAACAATTGGAATGCATCTCGAGATGCATTCCAATTGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-239s1c1
Sequence:CCGGCCTTCAACTCATGGAAGACTTCTCGAGAAGTCTTCCATGAGTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133984.1-1330s1c1
Sequence:CCGGTGTTTCTAGGAGACTTGGAAACTCGAGTTTCCAAGTCTCCTAGAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-568s1c1
Sequence:CCGGCCAGAGACAGAAGAACTGGTTCTCGAGAACCAGTTCTTCTGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-716s1c1
Sequence:CCGGGTCGAGTTGTTGCTGTGGATACTCGAGTATCCACAGCAACAACTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-1164s1c1
Sequence:CCGGTGTCCAGAAGTCTGCACCATACTCGAGTATGGTGCAGACTTCTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133984
VALIDATED
HEMK1 MISSION shRNA shRNA Plasmid DNA
HemK methyltransferase family member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-978s1c1
Sequence:CCGGCATGGACATCATCACCCACATCTCGAGATGTGGGTGATGATGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133984.1-1376s1c1
Sequence:CCGGCAGCAAAGAACAGAGACCCAACTCGAGTTGGGTCTCTGTTCTTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-801s1c1
Sequence:CCGGCCGGATCATCTGCCTTGATATCTCGAGATATCAAGGCAGATGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-1027s1c1
Sequence:CCGGGCCTCTGGAAGCATCTTCTTACTCGAGTAAGAAGATGCTTCCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-435s1c1
Sequence:CCGGCCCTCAACAATTGGAATGCATCTCGAGATGCATTCCAATTGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-239s1c1
Sequence:CCGGCCTTCAACTCATGGAAGACTTCTCGAGAAGTCTTCCATGAGTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133984.1-1330s1c1
Sequence:CCGGTGTTTCTAGGAGACTTGGAAACTCGAGTTTCCAAGTCTCCTAGAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-568s1c1
Sequence:CCGGCCAGAGACAGAAGAACTGGTTCTCGAGAACCAGTTCTTCTGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-716s1c1
Sequence:CCGGGTCGAGTTGTTGCTGTGGATACTCGAGTATCCACAGCAACAACTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-1164s1c1
Sequence:CCGGTGTCCAGAAGTCTGCACCATACTCGAGTATGGTGCAGACTTCTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133984
VALIDATED
HEMK1 MISSION shRNA Lentiviral Transduction Particles
HemK methyltransferase family member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-978s1c1
Sequence:CCGGCATGGACATCATCACCCACATCTCGAGATGTGGGTGATGATGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133984.1-1376s1c1
Sequence:CCGGCAGCAAAGAACAGAGACCCAACTCGAGTTGGGTCTCTGTTCTTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-801s1c1
Sequence:CCGGCCGGATCATCTGCCTTGATATCTCGAGATATCAAGGCAGATGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-1027s1c1
Sequence:CCGGGCCTCTGGAAGCATCTTCTTACTCGAGTAAGAAGATGCTTCCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-435s1c1
Sequence:CCGGCCCTCAACAATTGGAATGCATCTCGAGATGCATTCCAATTGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-239s1c1
Sequence:CCGGCCTTCAACTCATGGAAGACTTCTCGAGAAGTCTTCCATGAGTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133984.1-1330s1c1
Sequence:CCGGTGTTTCTAGGAGACTTGGAAACTCGAGTTTCCAAGTCTCCTAGAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133984.1-568s1c1
Sequence:CCGGCCAGAGACAGAAGAACTGGTTCTCGAGAACCAGTTCTTCTGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-716s1c1
Sequence:CCGGGTCGAGTTGTTGCTGTGGATACTCGAGTATCCACAGCAACAACTCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133984.1-1164s1c1
Sequence:CCGGTGTCCAGAAGTCTGCACCATACTCGAGTATGGTGCAGACTTCTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)