EMAIL THIS PAGE TO A FRIEND

HENMT1

HEN1 methyltransferase homolog 1 (Arabidopsis)

55 Gene Product Result for
Synonyms: C1orf59 HEN1
UniProtKB ID: Q5T8I9, A8MRR6, B1AM16, B1AM17, Q96EJ7, Q96NN0
Gene ID:
Mouse(66715) HEN1 methyltransferase homolog 1 (Arabidopsis)
Rat(100363095) HEN1 methyltransferase homolog 1 (Arabidopsis)
Zebrafish(550540) HEN1 methyltransferase homolog 1 (Arabidopsis)
chicken(429055) HEN1 methyltransferase homolog 1 (Arabidopsis)
domestic cat(101087676) HEN1 methyltransferase homolog 1 (Arabidopsis)
cow(515853) HEN1 methyltransferase homolog 1 (Arabidopsis)
sheep(101102695) HEN1 methyltransferase homolog 1 (Arabidopsis)
domestic guinea pig(100726074) HEN1 methyltransferase homolog 1 (Arabidopsis)
naked mole-rat(101718353) HEN1 methyltransferase homolog 1 (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102592 Rosetta Predictions human pricing
NM_144584 Rosetta Predictions human pricing
NM_001078646 Rosetta Predictions mouse pricing
NM_025723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323280 predicted 758
2 SASI_Hs02_00323281 predicted 799
3 SASI_Hs02_00323282 predicted 1016
4 SASI_Hs02_00323283 predicted 442
5 SASI_Hs02_00323284 predicted 759
6 SASI_Hs02_00323285 predicted 830
7 SASI_Hs02_00323286 predicted 456
8 SASI_Hs02_00323287 predicted 891
9 SASI_Hs02_00323288 predicted 600
10 SASI_Hs02_00323289 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032569 predicted 947
2 SASI_Hs01_00032570 predicted 981
3 SASI_Hs01_00032571 predicted 1195
4 SASI_Hs01_00032572 predicted 626
5 SASI_Hs01_00032573 predicted 935
6 SASI_Hs02_00364368 predicted 1017
7 SASI_Hs02_00364369 predicted 647
8 SASI_Hs02_00364370 predicted 1073
9 SASI_Hs01_00032575 predicted 788
10 SASI_Hs01_00032577 predicted 554
11 SASI_Hs01_00032574 predicted 498
12 SASI_Hs01_00032576 predicted 1130
13 SASI_Hs01_00032578 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292982 predicted 900
2 SASI_Mm02_00292983 predicted 228
3 SASI_Mm02_00292984 predicted 831
4 SASI_Mm02_00292985 predicted 761
5 SASI_Mm02_00292986 predicted 798
6 SASI_Mm02_00292987 predicted 863
7 SASI_Mm02_00292988 predicted 717
8 SASI_Mm02_00292989 predicted 457
9 SASI_Mm02_00292990 predicted 717
10 SASI_Mm02_00292991 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165674 predicted 1214
2 SASI_Mm01_00165675 predicted 548
3 SASI_Mm01_00165676 predicted 1144
4 SASI_Mm01_00165677 predicted 1074
5 SASI_Mm01_00165678 predicted 1113
6 SASI_Mm01_00165679 predicted 1172
7 SASI_Mm01_00165680 predicted 1038
8 SASI_Mm01_00165681 predicted 771
9 SASI_Mm01_00165682 predicted 1037
10 SASI_Mm01_00165683 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025723
HENMT1 MISSION shRNA Bacterial Glycerol Stock
HEN1 methyltransferase homolog 1 (Arabidopsis)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025723.1-903s1c1
Sequence:CCGGCCAGATTTCCTGATGTGGTTTCTCGAGAAACCACATCAGGAAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025723.1-1320s1c1
Sequence:CCGGGAGGCTGAGATACCAGAGAATCTCGAGATTCTCTGGTATCTCAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025723.1-1040s1c1
Sequence:CCGGGAGTTTCAGACCTGGGCTTTACTCGAGTAAAGCCCAGGTCTGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-1238s21c1
Sequence:CCGGACAACCTCCTACCCGAGTTTACTCGAGTAAACTCGGGTAGGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025723.2-1793s21c1
Sequence:CCGGCATCCTCAGCCCTAGAATTTACTCGAGTAAATTCTAGGGCTGAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-740s21c1
Sequence:CCGGCATCGCTTGTCTCCCTATTTGCTCGAGCAAATAGGGAGACAAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-551s21c1
Sequence:CCGGCGGTTCAAACCACCATTATACCTCGAGGTATAATGGTGGTTTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-1002s21c1
Sequence:CCGGTGAGGGACGCCGACCATAAATCTCGAGATTTATGGTCGGCGTCCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025723.2-1793s1c1
Sequence:CCGGCATCCTCAGCCCTAGAATTTACTCGAGTAAATTCTAGGGCTGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025723
HENMT1 MISSION shRNA shRNA Plasmid DNA
HEN1 methyltransferase homolog 1 (Arabidopsis)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025723.1-903s1c1
Sequence:CCGGCCAGATTTCCTGATGTGGTTTCTCGAGAAACCACATCAGGAAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025723.1-1320s1c1
Sequence:CCGGGAGGCTGAGATACCAGAGAATCTCGAGATTCTCTGGTATCTCAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025723.1-1040s1c1
Sequence:CCGGGAGTTTCAGACCTGGGCTTTACTCGAGTAAAGCCCAGGTCTGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-1238s21c1
Sequence:CCGGACAACCTCCTACCCGAGTTTACTCGAGTAAACTCGGGTAGGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025723.2-1793s21c1
Sequence:CCGGCATCCTCAGCCCTAGAATTTACTCGAGTAAATTCTAGGGCTGAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-740s21c1
Sequence:CCGGCATCGCTTGTCTCCCTATTTGCTCGAGCAAATAGGGAGACAAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-551s21c1
Sequence:CCGGCGGTTCAAACCACCATTATACCTCGAGGTATAATGGTGGTTTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-1002s21c1
Sequence:CCGGTGAGGGACGCCGACCATAAATCTCGAGATTTATGGTCGGCGTCCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025723.2-1793s1c1
Sequence:CCGGCATCCTCAGCCCTAGAATTTACTCGAGTAAATTCTAGGGCTGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025723
HENMT1 MISSION shRNA Lentiviral Transduction Particles
HEN1 methyltransferase homolog 1 (Arabidopsis)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025723.1-903s1c1
Sequence:CCGGCCAGATTTCCTGATGTGGTTTCTCGAGAAACCACATCAGGAAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025723.1-1320s1c1
Sequence:CCGGGAGGCTGAGATACCAGAGAATCTCGAGATTCTCTGGTATCTCAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025723.1-1040s1c1
Sequence:CCGGGAGTTTCAGACCTGGGCTTTACTCGAGTAAAGCCCAGGTCTGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-1238s21c1
Sequence:CCGGACAACCTCCTACCCGAGTTTACTCGAGTAAACTCGGGTAGGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025723.2-1793s21c1
Sequence:CCGGCATCCTCAGCCCTAGAATTTACTCGAGTAAATTCTAGGGCTGAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-740s21c1
Sequence:CCGGCATCGCTTGTCTCCCTATTTGCTCGAGCAAATAGGGAGACAAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-551s21c1
Sequence:CCGGCGGTTCAAACCACCATTATACCTCGAGGTATAATGGTGGTTTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025723.2-1002s21c1
Sequence:CCGGTGAGGGACGCCGACCATAAATCTCGAGATTTATGGTCGGCGTCCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025723.2-1793s1c1
Sequence:CCGGCATCCTCAGCCCTAGAATTTACTCGAGTAAATTCTAGGGCTGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144584
VALIDATED
HENMT1 MISSION shRNA Bacterial Glycerol Stock
HEN1 methyltransferase homolog 1 (Arabidopsis)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144584.1-1323s1c1
Sequence:CCGGCCAAAGACATTGGTGGCTCAACTCGAGTTGAGCCACCAATGTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144584.1-892s1c1
Sequence:CCGGGATTGTCATCAGCACACCAAACTCGAGTTTGGTGTGCTGATGACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144584.1-1638s1c1
Sequence:CCGGCGATAGTTGTGCTCACTTAGACTCGAGTCTAAGTGAGCACAACTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144584.1-485s1c1
Sequence:CCGGGAGACGGCAATTCAGTTTAAACTCGAGTTTAAACTGAATTGCCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-851s21c1
Sequence:CCGGAGATTTCCTGAAGTGGTATTTCTCGAGAAATACCACTTCAGGAAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144584.2-1673s21c1
Sequence:CCGGGTGTAATCCTAATTCAAGTAACTCGAGTTACTTGAATTAGGATTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-448s21c1
Sequence:CCGGTAGTGTGGTTGACGGTAATTTCTCGAGAAATTACCGTCAACCACACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-1467s21c1
Sequence:CCGGATCCCAAGTTGAACCGCTTATCTCGAGATAAGCGGTTCAACTTGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144584
VALIDATED
HENMT1 MISSION shRNA shRNA Plasmid DNA
HEN1 methyltransferase homolog 1 (Arabidopsis)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144584.1-1323s1c1
Sequence:CCGGCCAAAGACATTGGTGGCTCAACTCGAGTTGAGCCACCAATGTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144584.1-892s1c1
Sequence:CCGGGATTGTCATCAGCACACCAAACTCGAGTTTGGTGTGCTGATGACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144584.1-1638s1c1
Sequence:CCGGCGATAGTTGTGCTCACTTAGACTCGAGTCTAAGTGAGCACAACTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144584.1-485s1c1
Sequence:CCGGGAGACGGCAATTCAGTTTAAACTCGAGTTTAAACTGAATTGCCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-851s21c1
Sequence:CCGGAGATTTCCTGAAGTGGTATTTCTCGAGAAATACCACTTCAGGAAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144584.2-1673s21c1
Sequence:CCGGGTGTAATCCTAATTCAAGTAACTCGAGTTACTTGAATTAGGATTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-448s21c1
Sequence:CCGGTAGTGTGGTTGACGGTAATTTCTCGAGAAATTACCGTCAACCACACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-1467s21c1
Sequence:CCGGATCCCAAGTTGAACCGCTTATCTCGAGATAAGCGGTTCAACTTGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144584
VALIDATED
HENMT1 MISSION shRNA Lentiviral Transduction Particles
HEN1 methyltransferase homolog 1 (Arabidopsis)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144584.1-1323s1c1
Sequence:CCGGCCAAAGACATTGGTGGCTCAACTCGAGTTGAGCCACCAATGTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144584.1-892s1c1
Sequence:CCGGGATTGTCATCAGCACACCAAACTCGAGTTTGGTGTGCTGATGACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144584.1-1638s1c1
Sequence:CCGGCGATAGTTGTGCTCACTTAGACTCGAGTCTAAGTGAGCACAACTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144584.1-485s1c1
Sequence:CCGGGAGACGGCAATTCAGTTTAAACTCGAGTTTAAACTGAATTGCCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-851s21c1
Sequence:CCGGAGATTTCCTGAAGTGGTATTTCTCGAGAAATACCACTTCAGGAAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144584.2-1673s21c1
Sequence:CCGGGTGTAATCCTAATTCAAGTAACTCGAGTTACTTGAATTAGGATTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-448s21c1
Sequence:CCGGTAGTGTGGTTGACGGTAATTTCTCGAGAAATTACCGTCAACCACACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144584.2-1467s21c1
Sequence:CCGGATCCCAAGTTGAACCGCTTATCTCGAGATAAGCGGTTCAACTTGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)