EMAIL THIS PAGE TO A FRIEND

HEPACAM2

HEPACAM family member 2

56 Gene Product Result for
Synonyms: MIKI
UniProtKB ID: A8MVW5, B3KTT4, B4DPJ1, B9EG93, E9PDV5, Q6UXI0
Gene ID:
Mouse(101202) HEPACAM family member 2
Rat(296846) HEPACAM family member 2
sheep(101112557) HEPACAM family member 2
Domestic Rabbit(100342709) HEPACAM family member 2
domestic guinea pig(100733623) HEPACAM family member 2
naked mole-rat(101718637) HEPACAM family member 2
chicken(772177) HEPACAM family member 2
domestic cat(101085031) HEPACAM family member 2
cow(513430) HEPACAM family member 2
Horse(100061854) HEPACAM family member 2
dog(609954) HEPACAM family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198151 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039372 Rosetta Predictions human pricing
NM_198151 Rosetta Predictions human pricing
NM_001106580 Rosetta Predictions rat pricing
NM_178899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215047 predicted 877
2 SASI_Hs01_00215048 predicted 726
3 SASI_Hs01_00215049 predicted 545
4 SASI_Hs01_00215050 predicted 816
5 SASI_Hs01_00215051 predicted 863
6 SASI_Hs01_00215052 predicted 1035
7 SASI_Hs01_00215053 predicted 720
8 SASI_Hs01_00215054 predicted 735
9 SASI_Hs02_00308472 predicted 927
10 SASI_Hs01_00215055 predicted 1005
11 SASI_Hs01_00215056 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015159 predicted 878
2 SASI_Hs01_00015160 predicted 728
3 SASI_Hs01_00015161 predicted 553
4 SASI_Hs01_00015162 predicted 817
5 SASI_Hs01_00015163 predicted 863
6 SASI_Hs01_00015164 predicted 1037
7 SASI_Hs01_00015165 predicted 728
8 SASI_Hs01_00015166 predicted 747
9 SASI_Hs02_00371687 predicted 930
10 SASI_Hs01_00015167 predicted 1009
11 SASI_Hs01_00015168 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220348 predicted 879
2 SASI_Rn02_00220349 predicted 651
3 SASI_Rn02_00220350 predicted 218
4 SASI_Rn02_00220351 predicted 499
5 SASI_Rn02_00220352 predicted 502
6 SASI_Rn02_00220353 predicted 725
7 SASI_Rn02_00220354 predicted 739
8 SASI_Rn02_00220355 predicted 909
9 SASI_Rn02_00220356 predicted 741
10 SASI_Rn02_00220357 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044139 predicted 740
2 SASI_Mm01_00044140 predicted 202
3 SASI_Mm01_00044141 predicted 1077
4 SASI_Mm01_00044142 predicted 878
5 SASI_Mm02_00349499 predicted 350
6 SASI_Mm01_00044144 predicted 214
7 SASI_Mm01_00044145 predicted 1500
8 SASI_Mm01_00044146 predicted 877
9 SASI_Mm01_00044147 predicted 545
10 SASI_Mm01_00044148 predicted 499
11 SASI_Mm01_00044143 predicted 1501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198151
HEPACAM2 MISSION shRNA Bacterial Glycerol Stock
HEPACAM family member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1527s1c1
Sequence:CCGGCCTCTTACTCATTATTCCTTTCTCGAGAAAGGAATAATGAGTAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-208s1c1
Sequence:CCGGGCATCAGACATCCAGATCATACTCGAGTATGATCTGGATGTCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-433s1c1
Sequence:CCGGCAGAAGATACAAGTCACGGTTCTCGAGAACCGTGACTTGTATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1504s1c1
Sequence:CCGGCAGTGAAGAAACCAGGACCAACTCGAGTTGGTCCTGGTTTCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-449s1c1
Sequence:CCGGCGGTTGATGATCCTGTCACAACTCGAGTTGTGACAGGATCATCAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-946s1c1
Sequence:CCGGGCCCAGAAGACAATGGACTATCTCGAGATAGTCCATTGTCTTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-948s1c1
Sequence:CCGGCCAGAAGACAATGGACTATGTCTCGAGACATAGTCCATTGTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-995s1c1
Sequence:CCGGGCAGGCAAGATGAAACTCATTCTCGAGAATGAGTTTCATCTTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1549s1c1
Sequence:CCGGCATGCAGAATAGAGGCATTTACTCGAGTAAATGCCTCTATTCTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-219s1c1
Sequence:CCGGCCAGATCATATGGCTATTTGACTCGAGTCAAATAGCCATATGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-879s1c1
Sequence:CCGGGAGGACTGACAATACTACATACTCGAGTATGTAGTATTGTCAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198151
HEPACAM2 MISSION shRNA shRNA Plasmid DNA
HEPACAM family member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1527s1c1
Sequence:CCGGCCTCTTACTCATTATTCCTTTCTCGAGAAAGGAATAATGAGTAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-208s1c1
Sequence:CCGGGCATCAGACATCCAGATCATACTCGAGTATGATCTGGATGTCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-433s1c1
Sequence:CCGGCAGAAGATACAAGTCACGGTTCTCGAGAACCGTGACTTGTATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1504s1c1
Sequence:CCGGCAGTGAAGAAACCAGGACCAACTCGAGTTGGTCCTGGTTTCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-449s1c1
Sequence:CCGGCGGTTGATGATCCTGTCACAACTCGAGTTGTGACAGGATCATCAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-946s1c1
Sequence:CCGGGCCCAGAAGACAATGGACTATCTCGAGATAGTCCATTGTCTTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-948s1c1
Sequence:CCGGCCAGAAGACAATGGACTATGTCTCGAGACATAGTCCATTGTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-995s1c1
Sequence:CCGGGCAGGCAAGATGAAACTCATTCTCGAGAATGAGTTTCATCTTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1549s1c1
Sequence:CCGGCATGCAGAATAGAGGCATTTACTCGAGTAAATGCCTCTATTCTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-219s1c1
Sequence:CCGGCCAGATCATATGGCTATTTGACTCGAGTCAAATAGCCATATGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-879s1c1
Sequence:CCGGGAGGACTGACAATACTACATACTCGAGTATGTAGTATTGTCAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198151
HEPACAM2 MISSION shRNA Lentiviral Transduction Particles
HEPACAM family member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1527s1c1
Sequence:CCGGCCTCTTACTCATTATTCCTTTCTCGAGAAAGGAATAATGAGTAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-208s1c1
Sequence:CCGGGCATCAGACATCCAGATCATACTCGAGTATGATCTGGATGTCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-433s1c1
Sequence:CCGGCAGAAGATACAAGTCACGGTTCTCGAGAACCGTGACTTGTATCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1504s1c1
Sequence:CCGGCAGTGAAGAAACCAGGACCAACTCGAGTTGGTCCTGGTTTCTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-449s1c1
Sequence:CCGGCGGTTGATGATCCTGTCACAACTCGAGTTGTGACAGGATCATCAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-946s1c1
Sequence:CCGGGCCCAGAAGACAATGGACTATCTCGAGATAGTCCATTGTCTTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-948s1c1
Sequence:CCGGCCAGAAGACAATGGACTATGTCTCGAGACATAGTCCATTGTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-995s1c1
Sequence:CCGGGCAGGCAAGATGAAACTCATTCTCGAGAATGAGTTTCATCTTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198151.1-1549s1c1
Sequence:CCGGCATGCAGAATAGAGGCATTTACTCGAGTAAATGCCTCTATTCTGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-219s1c1
Sequence:CCGGCCAGATCATATGGCTATTTGACTCGAGTCAAATAGCCATATGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198151.1-879s1c1
Sequence:CCGGGAGGACTGACAATACTACATACTCGAGTATGTAGTATTGTCAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178899
HEPACAM2 MISSION shRNA Bacterial Glycerol Stock
HEPACAM family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-1006s1c1
Sequence:CCGGCTCGATTCACAGTCATCATAACTCGAGTTATGATGACTGTGAATCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-260s1c1
Sequence:CCGGCTTGCTAGGCTCCGTTAATAACTCGAGTTATTAACGGAGCCTAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-745s1c1
Sequence:CCGGCTTATGGACTTCAGGTTAATTCTCGAGAATTAACCTGAAGTCCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-1163s1c1
Sequence:CCGGGCTATAAGACAGAAGCTAGAACTCGAGTTCTAGCTTCTGTCTTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178899.3-1666s1c1
Sequence:CCGGCCCTAGTTACTTGCTACTGAACTCGAGTTCAGTAGCAAGTAACTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-206s1c1
Sequence:CCGGGCATCTGACATCCAGATCATACTCGAGTATGATCTGGATGTCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178899.3-1779s1c1
Sequence:CCGGCCTTGGTAGATGTTCGCAATACTCGAGTATTGCGAACATCTACCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-1354s1c1
Sequence:CCGGCGGAACAATTTATGAAGTCATCTCGAGATGACTTCATAAATTGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178899
HEPACAM2 MISSION shRNA shRNA Plasmid DNA
HEPACAM family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-1006s1c1
Sequence:CCGGCTCGATTCACAGTCATCATAACTCGAGTTATGATGACTGTGAATCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-260s1c1
Sequence:CCGGCTTGCTAGGCTCCGTTAATAACTCGAGTTATTAACGGAGCCTAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-745s1c1
Sequence:CCGGCTTATGGACTTCAGGTTAATTCTCGAGAATTAACCTGAAGTCCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-1163s1c1
Sequence:CCGGGCTATAAGACAGAAGCTAGAACTCGAGTTCTAGCTTCTGTCTTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178899.3-1666s1c1
Sequence:CCGGCCCTAGTTACTTGCTACTGAACTCGAGTTCAGTAGCAAGTAACTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-206s1c1
Sequence:CCGGGCATCTGACATCCAGATCATACTCGAGTATGATCTGGATGTCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178899.3-1779s1c1
Sequence:CCGGCCTTGGTAGATGTTCGCAATACTCGAGTATTGCGAACATCTACCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-1354s1c1
Sequence:CCGGCGGAACAATTTATGAAGTCATCTCGAGATGACTTCATAAATTGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178899
HEPACAM2 MISSION shRNA Lentiviral Transduction Particles
HEPACAM family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-1006s1c1
Sequence:CCGGCTCGATTCACAGTCATCATAACTCGAGTTATGATGACTGTGAATCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-260s1c1
Sequence:CCGGCTTGCTAGGCTCCGTTAATAACTCGAGTTATTAACGGAGCCTAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.5-745s1c1
Sequence:CCGGCTTATGGACTTCAGGTTAATTCTCGAGAATTAACCTGAAGTCCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-1163s1c1
Sequence:CCGGGCTATAAGACAGAAGCTAGAACTCGAGTTCTAGCTTCTGTCTTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178899.3-1666s1c1
Sequence:CCGGCCCTAGTTACTTGCTACTGAACTCGAGTTCAGTAGCAAGTAACTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-206s1c1
Sequence:CCGGGCATCTGACATCCAGATCATACTCGAGTATGATCTGGATGTCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178899.3-1779s1c1
Sequence:CCGGCCTTGGTAGATGTTCGCAATACTCGAGTATTGCGAACATCTACCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178899.3-1354s1c1
Sequence:CCGGCGGAACAATTTATGAAGTCATCTCGAGATGACTTCATAAATTGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)