EMAIL THIS PAGE TO A FRIEND

HEPACAM

hepatic and glial cell adhesion molecule

74 Gene Product Result for
Synonyms: GlialCAM MLC2A MLC2B
UniProtKB ID: Q14CZ8, Q67IP8, Q6ZWL4, Q8N7I3, Q8ND35
Gene ID:
Human(220296) Summary: The protein encoded by this gene is a single-pass type I membrane protein that localizes to the cytoplasmic side of the cell membrane. The encoded protein acts as a homodimer and is involved in cell motility and cell-matrix interactions. The expression of this gene is downregulated or undetectable in many cancer cell lines, so this may be a tumor suppressor gene. [provided by RefSeq, Jul 2011]
Mouse(72927) hepatocyte cell adhesion molecule
Zebrafish(100005952) hepatocyte cell adhesion molecule
chicken(428234) hepatic and glial cell adhesion molecule
dog(489305) hepatic and glial cell adhesion molecule
domestic cat(101085235) hepatic and glial cell adhesion molecule
Horse(100064233) hepatic and glial cell adhesion molecule
cow(521015) hepatic and glial cell adhesion molecule
domestic guinea pig(100722178) hepatic and glial cell adhesion molecule
naked mole-rat(101725184) hepatic and glial cell adhesion molecule
sheep(101109223) hepatic and glial cell adhesion molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152722 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154351 MISSION® esiRNA esiRNA human HEPACAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152722 Rosetta Predictions human pricing
NM_175189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158873 predicted 890
2 SASI_Hs02_00366625 predicted 1781
3 SASI_Hs01_00158874 predicted 689
4 SASI_Hs01_00158875 predicted 829
5 SASI_Hs01_00158876 predicted 812
6 SASI_Hs01_00158877 predicted 1109
7 SASI_Hs01_00158878 predicted 1292
8 SASI_Hs01_00158880 predicted 1157
9 SASI_Hs01_00158881 predicted 1204
10 SASI_Hs02_00366626 predicted 745
11 SASI_Hs01_00158879 predicted 1473
12 SASI_Hs01_00158882 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157385 predicted 562
2 SASI_Mm02_00345850 predicted 818
3 SASI_Mm01_00157386 predicted 978
4 SASI_Mm01_00157387 predicted 490
5 SASI_Mm02_00345851 predicted 987
6 SASI_Mm01_00157388 predicted 509
7 SASI_Mm01_00157389 predicted 777
8 SASI_Mm01_00157390 predicted 924
9 SASI_Mm01_00157391 predicted 758
10 SASI_Mm01_00157392 predicted 474
11 SASI_Mm01_00157384 predicted 1004
12 SASI_Mm01_00157393 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152722
HEPACAM MISSION shRNA Bacterial Glycerol Stock
hepatic and glial cell adhesion molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-539s1c1
Sequence:CCGGCTTGAACTGCTCACATGAGAACTCGAGTTCTCATGTGAGCAGTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-894s1c1
Sequence:CCGGCAGAATGATGACCGCCTGAAACTCGAGTTTCAGGCGGTCATCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-731s1c1
Sequence:CCGGGCCTGTCAAGATCACCGTATACTCGAGTATACGGTGATCTTGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-548s1c1
Sequence:CCGGCTCACATGAGAATGGCACCAACTCGAGTTGGTGCCATTCTCATGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-763s1c1
Sequence:CCGGCCCTTTACATCATCTTGTCTACTCGAGTAGACAAGATGATGTAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152722
HEPACAM MISSION shRNA shRNA Plasmid DNA
hepatic and glial cell adhesion molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-539s1c1
Sequence:CCGGCTTGAACTGCTCACATGAGAACTCGAGTTCTCATGTGAGCAGTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-894s1c1
Sequence:CCGGCAGAATGATGACCGCCTGAAACTCGAGTTTCAGGCGGTCATCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-731s1c1
Sequence:CCGGGCCTGTCAAGATCACCGTATACTCGAGTATACGGTGATCTTGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-548s1c1
Sequence:CCGGCTCACATGAGAATGGCACCAACTCGAGTTGGTGCCATTCTCATGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-763s1c1
Sequence:CCGGCCCTTTACATCATCTTGTCTACTCGAGTAGACAAGATGATGTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152722
HEPACAM MISSION shRNA Lentiviral Transduction Particles
hepatic and glial cell adhesion molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-539s1c1
Sequence:CCGGCTTGAACTGCTCACATGAGAACTCGAGTTCTCATGTGAGCAGTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-894s1c1
Sequence:CCGGCAGAATGATGACCGCCTGAAACTCGAGTTTCAGGCGGTCATCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-731s1c1
Sequence:CCGGGCCTGTCAAGATCACCGTATACTCGAGTATACGGTGATCTTGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-548s1c1
Sequence:CCGGCTCACATGAGAATGGCACCAACTCGAGTTGGTGCCATTCTCATGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152722.3-763s1c1
Sequence:CCGGCCCTTTACATCATCTTGTCTACTCGAGTAGACAAGATGATGTAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175189
HEPACAM MISSION shRNA Bacterial Glycerol Stock
hepatic and glial cell adhesion molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-1002s1c1
Sequence:CCGGGCACTCTATATCCTGAAGGATCTCGAGATCCTTCAGGATATAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-924s1c1
Sequence:CCGGGATCAGAATGATGACCGCCTACTCGAGTAGGCGGTCATCATTCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-357s1c1
Sequence:CCGGCGAGACCGTATCCGGCTCTTTCTCGAGAAAGAGCCGGATACGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-790s1c1
Sequence:CCGGCCCTCTATATCATCTTGTCTACTCGAGTAGACAAGATGATATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175189.4-1752s1c1
Sequence:CCGGGCCCAATTTAGAGGCCACTTACTCGAGTAAGTGGCCTCTAAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175189
HEPACAM MISSION shRNA shRNA Plasmid DNA
hepatic and glial cell adhesion molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-1002s1c1
Sequence:CCGGGCACTCTATATCCTGAAGGATCTCGAGATCCTTCAGGATATAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-924s1c1
Sequence:CCGGGATCAGAATGATGACCGCCTACTCGAGTAGGCGGTCATCATTCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-357s1c1
Sequence:CCGGCGAGACCGTATCCGGCTCTTTCTCGAGAAAGAGCCGGATACGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-790s1c1
Sequence:CCGGCCCTCTATATCATCTTGTCTACTCGAGTAGACAAGATGATATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175189.4-1752s1c1
Sequence:CCGGGCCCAATTTAGAGGCCACTTACTCGAGTAAGTGGCCTCTAAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175189
HEPACAM MISSION shRNA Lentiviral Transduction Particles
hepatic and glial cell adhesion molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-1002s1c1
Sequence:CCGGGCACTCTATATCCTGAAGGATCTCGAGATCCTTCAGGATATAGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-924s1c1
Sequence:CCGGGATCAGAATGATGACCGCCTACTCGAGTAGGCGGTCATCATTCTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-357s1c1
Sequence:CCGGCGAGACCGTATCCGGCTCTTTCTCGAGAAAGAGCCGGATACGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175189.4-790s1c1
Sequence:CCGGCCCTCTATATCATCTTGTCTACTCGAGTAGACAAGATGATATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175189.4-1752s1c1
Sequence:CCGGGCCCAATTTAGAGGCCACTTACTCGAGTAAGTGGCCTCTAAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)