EMAIL THIS PAGE TO A FRIEND

HEPH

hephaestin

131 Gene Product Result for
Synonyms: CPL
Gene ID:
Human(9843) Summary: The protein encoded by this gene is similar to an iron transport protein found in mouse. The mouse protein is similar to ceruloplasmin, a serum multi-copper ferroxidase, and is thought to be a membrane-bound protein responsible for transport of dietary iron from epithelial cells of the intestinal lumen into the circulatory system. In mouse, defects in this gene can lead to severe microcytic anemia. Three transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2008]
Mouse(15203) hephaestin
Rat(117240) hephaestin
fruit fly(48571) hephaestus
cow(510736) hephaestin
Horse(100065379) hephaestin
dog(491926) hephaestin
chicken(422168) hephaestin
sheep(101113655) hephaestin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014799 Rosetta Predictions human pricing
NM_138737 Rosetta Predictions human pricing
NM_133304 Rosetta Predictions rat pricing
NM_010417 Rosetta Predictions mouse pricing
NM_181273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212780 predicted 2796
2 SASI_Hs01_00212781 predicted 1288
3 SASI_Hs01_00212782 predicted 1327
4 SASI_Hs02_00346305 predicted 3522
5 SASI_Hs01_00212783 predicted 3086
6 SASI_Hs01_00212784 predicted 2451
7 SASI_Hs01_00212785 predicted 2250
8 SASI_Hs02_00346306 predicted 2784
9 SASI_Hs01_00212787 predicted 2884
10 SASI_Hs01_00212789 predicted 1059
11 SASI_Hs01_00212786 predicted 1336
12 SASI_Hs01_00212788 predicted 2012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242699 predicted 1316
2 SASI_Hs01_00242700 predicted 615
3 SASI_Hs01_00242701 predicted 1363
4 SASI_Hs01_00242702 predicted 3124
5 SASI_Hs01_00242703 predicted 2490
6 SASI_Hs01_00242704 predicted 2284
7 SASI_Hs02_00363857 predicted 2813
8 SASI_Hs01_00242706 predicted 2911
9 SASI_Hs01_00242707 predicted 801
10 SASI_Hs02_00363858 predicted 1088
11 SASI_Hs01_00242698 predicted 2829
12 SASI_Hs01_00242705 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098728 predicted 289
2 SASI_Rn01_00098729 predicted 2289
3 SASI_Rn01_00098730 predicted 1976
4 SASI_Rn01_00098731 predicted 2833
5 SASI_Rn01_00098732 predicted 2135
6 SASI_Rn01_00098734 predicted 3370
7 SASI_Rn01_00098735 predicted 2065
8 SASI_Rn01_00098736 predicted 1920
9 SASI_Rn02_00267597 predicted 2805
10 SASI_Rn01_00098737 predicted 1154
11 SASI_Rn01_00098733 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187078 predicted 2675
2 SASI_Mm01_00187079 predicted 988
3 SASI_Mm01_00187080 predicted 1869
4 SASI_Mm01_00187081 predicted 906
5 SASI_Mm01_00187082 predicted 2798
6 SASI_Mm01_00187083 predicted 1425
7 SASI_Mm01_00187084 predicted 2879
8 SASI_Mm01_00187085 predicted 2466
9 SASI_Mm01_00187086 predicted 1197
10 SASI_Mm01_00187087 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056206 predicted 2402
2 SASI_Mm01_00056207 predicted 834
3 SASI_Mm01_00056208 predicted 1722
4 SASI_Mm01_00056209 predicted 761
5 SASI_Mm01_00056210 predicted 2525
6 SASI_Mm01_00056211 predicted 1276
7 SASI_Mm01_00056212 predicted 2609
8 SASI_Mm01_00056213 predicted 2185
9 SASI_Mm01_00056214 predicted 1052
10 SASI_Mm01_00056215 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014799
HEPH MISSION shRNA Bacterial Glycerol Stock
hephaestin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014799.2-2458s21c1
Sequence:CCGGGGGAATCTTGGGTCCACTTATCTCGAGATAAGTGGACCCAAGATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1261s1c1
Sequence:CCGGGCCAGGCAGTATCTCAGATAACTCGAGTTATCTGAGATACTGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1849s1c1
Sequence:CCGGCCGACTGCTTTCAGAGGATATCTCGAGATATCCTCTGAAAGCAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-2652s1c1
Sequence:CCGGCCAATGACTCTGCTTGTGTTTCTCGAGAAACACAAGCAGAGTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-2102s1c1
Sequence:CCGGCCTGACAACCTTGGGACATTTCTCGAGAAATGTCCCAAGGTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1567s1c1
Sequence:CCGGGCCCTTTGAGAAAGTAACATACTCGAGTATGTTACTTTCTCAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014799.2-3635s21c1
Sequence:CCGGTCAAGCTTATCTGGATATTTCCTCGAGGAAATATCCAGATAAGCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014799.2-1888s21c1
Sequence:CCGGCAATCGGATGCATGCCATTAACTCGAGTTAATGGCATGCATCCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014799
HEPH MISSION shRNA shRNA Plasmid DNA
hephaestin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014799.2-2458s21c1
Sequence:CCGGGGGAATCTTGGGTCCACTTATCTCGAGATAAGTGGACCCAAGATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1261s1c1
Sequence:CCGGGCCAGGCAGTATCTCAGATAACTCGAGTTATCTGAGATACTGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1849s1c1
Sequence:CCGGCCGACTGCTTTCAGAGGATATCTCGAGATATCCTCTGAAAGCAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-2652s1c1
Sequence:CCGGCCAATGACTCTGCTTGTGTTTCTCGAGAAACACAAGCAGAGTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-2102s1c1
Sequence:CCGGCCTGACAACCTTGGGACATTTCTCGAGAAATGTCCCAAGGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1567s1c1
Sequence:CCGGGCCCTTTGAGAAAGTAACATACTCGAGTATGTTACTTTCTCAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014799.2-3635s21c1
Sequence:CCGGTCAAGCTTATCTGGATATTTCCTCGAGGAAATATCCAGATAAGCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014799.2-1888s21c1
Sequence:CCGGCAATCGGATGCATGCCATTAACTCGAGTTAATGGCATGCATCCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014799
HEPH MISSION shRNA Lentiviral Transduction Particles
hephaestin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014799.2-2458s21c1
Sequence:CCGGGGGAATCTTGGGTCCACTTATCTCGAGATAAGTGGACCCAAGATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1261s1c1
Sequence:CCGGGCCAGGCAGTATCTCAGATAACTCGAGTTATCTGAGATACTGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1849s1c1
Sequence:CCGGCCGACTGCTTTCAGAGGATATCTCGAGATATCCTCTGAAAGCAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-2652s1c1
Sequence:CCGGCCAATGACTCTGCTTGTGTTTCTCGAGAAACACAAGCAGAGTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-2102s1c1
Sequence:CCGGCCTGACAACCTTGGGACATTTCTCGAGAAATGTCCCAAGGTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014799.2-1567s1c1
Sequence:CCGGGCCCTTTGAGAAAGTAACATACTCGAGTATGTTACTTTCTCAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014799.2-3635s21c1
Sequence:CCGGTCAAGCTTATCTGGATATTTCCTCGAGGAAATATCCAGATAAGCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014799.2-1888s21c1
Sequence:CCGGCAATCGGATGCATGCCATTAACTCGAGTTAATGGCATGCATCCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010417
HEPH MISSION shRNA Bacterial Glycerol Stock
hephaestin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-3823s1c1
Sequence:CCGGCAGCACTATGACCACTATTACCTCGAGGTAATAGTGGTCATAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-1787s1c1
Sequence:CCGGCAATGGGACTATGGTCCAATACTCGAGTATTGGACCATAGTCCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-2944s1c1
Sequence:CCGGCCTGGGTTCCAAATATAAGAACTCGAGTTCTTATATTTGGAACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-716s1c1
Sequence:CCGGCAGGATATGCAGTGGAACTATCTCGAGATAGTTCCACTGCATATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-3082s1c1
Sequence:CCGGGACTGTAGTGTTCAAGAATAACTCGAGTTATTCTTGAACACTACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4519s1c1
Sequence:CCGGGAGGACAAAGAACATAAGTATCTCGAGATACTTATGTTCTTTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-2735s1c1
Sequence:CCGGGAAGGGATGCAGGCAATTTATCTCGAGATAAATTGCCTGCATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-1275s1c1
Sequence:CCGGGGAAGGATGTGGACCATAATTCTCGAGAATTATGGTCCACATCCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4506s1c1
Sequence:CCGGCCATAACTAAATAGAGGACAACTCGAGTTGTCCTCTATTTAGTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4102s1c1
Sequence:CCGGGCCTGAAGATATCTTCAGAAACTCGAGTTTCTGAAGATATCTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010417
HEPH MISSION shRNA shRNA Plasmid DNA
hephaestin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-3823s1c1
Sequence:CCGGCAGCACTATGACCACTATTACCTCGAGGTAATAGTGGTCATAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-1787s1c1
Sequence:CCGGCAATGGGACTATGGTCCAATACTCGAGTATTGGACCATAGTCCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-2944s1c1
Sequence:CCGGCCTGGGTTCCAAATATAAGAACTCGAGTTCTTATATTTGGAACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-716s1c1
Sequence:CCGGCAGGATATGCAGTGGAACTATCTCGAGATAGTTCCACTGCATATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-3082s1c1
Sequence:CCGGGACTGTAGTGTTCAAGAATAACTCGAGTTATTCTTGAACACTACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4519s1c1
Sequence:CCGGGAGGACAAAGAACATAAGTATCTCGAGATACTTATGTTCTTTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-2735s1c1
Sequence:CCGGGAAGGGATGCAGGCAATTTATCTCGAGATAAATTGCCTGCATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-1275s1c1
Sequence:CCGGGGAAGGATGTGGACCATAATTCTCGAGAATTATGGTCCACATCCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4506s1c1
Sequence:CCGGCCATAACTAAATAGAGGACAACTCGAGTTGTCCTCTATTTAGTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4102s1c1
Sequence:CCGGGCCTGAAGATATCTTCAGAAACTCGAGTTTCTGAAGATATCTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010417
HEPH MISSION shRNA Lentiviral Transduction Particles
hephaestin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-3823s1c1
Sequence:CCGGCAGCACTATGACCACTATTACCTCGAGGTAATAGTGGTCATAGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-1787s1c1
Sequence:CCGGCAATGGGACTATGGTCCAATACTCGAGTATTGGACCATAGTCCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-2944s1c1
Sequence:CCGGCCTGGGTTCCAAATATAAGAACTCGAGTTCTTATATTTGGAACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-716s1c1
Sequence:CCGGCAGGATATGCAGTGGAACTATCTCGAGATAGTTCCACTGCATATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-3082s1c1
Sequence:CCGGGACTGTAGTGTTCAAGAATAACTCGAGTTATTCTTGAACACTACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4519s1c1
Sequence:CCGGGAGGACAAAGAACATAAGTATCTCGAGATACTTATGTTCTTTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-2735s1c1
Sequence:CCGGGAAGGGATGCAGGCAATTTATCTCGAGATAAATTGCCTGCATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010417.1-1275s1c1
Sequence:CCGGGGAAGGATGTGGACCATAATTCTCGAGAATTATGGTCCACATCCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4506s1c1
Sequence:CCGGCCATAACTAAATAGAGGACAACTCGAGTTGTCCTCTATTTAGTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010417.1-4102s1c1
Sequence:CCGGGCCTGAAGATATCTTCAGAAACTCGAGTTTCTGAAGATATCTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)