EMAIL THIS PAGE TO A FRIEND

HERC2

HECT and RLD domain containing E3 ubiquitin protein ligase 2

94 Gene Product Result for
Synonyms: D15F37S1 SHEP1 jdf2 p528
Gene ID:
Human(8924) Summary: This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
Mouse(15204) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2
Rat(308669) HECT and RLD domain containing E3 ubiquitin protein ligase 2
domestic guinea pig(100731329) HECT and RLD domain containing E3 ubiquitin protein ligase 2
naked mole-rat(101713485) HECT and RLD domain containing E3 ubiquitin protein ligase 2
Zebrafish(558479) hect domain and RLD 2
cow(535440) HECT and RLD domain containing E3 ubiquitin protein ligase 2
Horse(100050955) HECT and RLD domain containing E3 ubiquitin protein ligase 2
dog(479005) HECT and RLD domain containing E3 ubiquitin protein ligase 2
fruit fly(33035) CG11734 gene product from transcript CG11734-RC
chicken(418682) HECT and RLD domain containing E3 ubiquitin protein ligase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004667 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004667 Rosetta Predictions human pricing
NM_001107520 Rosetta Predictions rat pricing
NM_010418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156697 predicted 8956
2 SASI_Hs01_00156698 predicted 11893
3 SASI_Hs02_00338089 predicted 1909
4 SASI_Hs01_00156700 predicted 7831
5 SASI_Hs01_00156701 predicted 434
6 SASI_Hs01_00156702 predicted 3275
7 SASI_Hs01_00156703 predicted 2118
8 SASI_Hs01_00156704 predicted 13555
9 SASI_Hs01_00156705 predicted 13325
10 SASI_Hs01_00156706 predicted 6766
11 SASI_Hs01_00156699 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229635 predicted 11346
2 SASI_Rn02_00229636 predicted 8299
3 SASI_Rn02_00229637 predicted 12262
4 SASI_Rn02_00229638 predicted 8900
5 SASI_Rn02_00229639 predicted 2772
6 SASI_Rn02_00229640 predicted 13999
7 SASI_Rn02_00229641 predicted 7723
8 SASI_Rn02_00229642 predicted 3609
9 SASI_Rn02_00229643 predicted 12896
10 SASI_Rn02_00229644 predicted 8357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056858 predicted 8755
2 SASI_Mm02_00318560 predicted 3895
3 SASI_Mm01_00056859 predicted 8079
4 SASI_Mm01_00056860 predicted 3411
5 SASI_Mm01_00056863 predicted 12442
6 SASI_Mm01_00056864 predicted 8533
7 SASI_Mm02_00318561 predicted 2947
8 SASI_Mm01_00056865 predicted 5415
9 SASI_Mm02_00318562 predicted 7819
10 SASI_Mm02_00318563 predicted 5513
11 SASI_Mm01_00056857 predicted 6061
12 SASI_Mm01_00056861 predicted 8520
13 SASI_Mm01_00056862 predicted 14107
14 SASI_Mm01_00056866 predicted 7868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010418
VALIDATED
HERC2 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-1643s21c1
Sequence:CCGGGCCTCCAGAAACATTGTGAAACTCGAGTTTCACAATGTTTCTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010418.2-14901s21c1
Sequence:CCGGACCGATAGGACCTAGTGTTTACTCGAGTAAACACTAGGTCCTATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-11766s21c1
Sequence:CCGGGCTGCGCAGAGACCCATAAATCTCGAGATTTATGGGTCTCTGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-5971s1c1
Sequence:CCGGGCGTTATTAACTTACTGCAAACTCGAGTTTGCAGTAAGTTAATAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-3348s21c1
Sequence:CCGGGCCTGCTCATTAGTAAACTTTCTCGAGAAAGTTTACTAATGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010418.1-1545s1c1
Sequence:CCGGGCCTCCAGAAACATTGTGAAACTCGAGTTTCACAATGTTTCTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-11425s1c1
Sequence:CCGGCCACAGAATTTGGGCAGTCAACTCGAGTTGACTGCCCAAATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010418.1-518s1c1
Sequence:CCGGGCGCTACTTCATTGCCTTGAACTCGAGTTCAAGGCAATGAAGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-3250s1c1
Sequence:CCGGGCCTGCTCATTAGTAAACTTTCTCGAGAAAGTTTACTAATGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-616s21c1
Sequence:CCGGGCGCTACTTCATTGCCTTGAACTCGAGTTCAAGGCAATGAAGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010418
VALIDATED
HERC2 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-1643s21c1
Sequence:CCGGGCCTCCAGAAACATTGTGAAACTCGAGTTTCACAATGTTTCTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010418.2-14901s21c1
Sequence:CCGGACCGATAGGACCTAGTGTTTACTCGAGTAAACACTAGGTCCTATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-11766s21c1
Sequence:CCGGGCTGCGCAGAGACCCATAAATCTCGAGATTTATGGGTCTCTGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-5971s1c1
Sequence:CCGGGCGTTATTAACTTACTGCAAACTCGAGTTTGCAGTAAGTTAATAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-3348s21c1
Sequence:CCGGGCCTGCTCATTAGTAAACTTTCTCGAGAAAGTTTACTAATGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010418.1-1545s1c1
Sequence:CCGGGCCTCCAGAAACATTGTGAAACTCGAGTTTCACAATGTTTCTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-11425s1c1
Sequence:CCGGCCACAGAATTTGGGCAGTCAACTCGAGTTGACTGCCCAAATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010418.1-518s1c1
Sequence:CCGGGCGCTACTTCATTGCCTTGAACTCGAGTTCAAGGCAATGAAGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-3250s1c1
Sequence:CCGGGCCTGCTCATTAGTAAACTTTCTCGAGAAAGTTTACTAATGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-616s21c1
Sequence:CCGGGCGCTACTTCATTGCCTTGAACTCGAGTTCAAGGCAATGAAGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010418
VALIDATED
HERC2 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-1643s21c1
Sequence:CCGGGCCTCCAGAAACATTGTGAAACTCGAGTTTCACAATGTTTCTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010418.2-14901s21c1
Sequence:CCGGACCGATAGGACCTAGTGTTTACTCGAGTAAACACTAGGTCCTATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-11766s21c1
Sequence:CCGGGCTGCGCAGAGACCCATAAATCTCGAGATTTATGGGTCTCTGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-5971s1c1
Sequence:CCGGGCGTTATTAACTTACTGCAAACTCGAGTTTGCAGTAAGTTAATAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-3348s21c1
Sequence:CCGGGCCTGCTCATTAGTAAACTTTCTCGAGAAAGTTTACTAATGAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010418.1-1545s1c1
Sequence:CCGGGCCTCCAGAAACATTGTGAAACTCGAGTTTCACAATGTTTCTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-11425s1c1
Sequence:CCGGCCACAGAATTTGGGCAGTCAACTCGAGTTGACTGCCCAAATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010418.1-518s1c1
Sequence:CCGGGCGCTACTTCATTGCCTTGAACTCGAGTTCAAGGCAATGAAGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010418.1-3250s1c1
Sequence:CCGGGCCTGCTCATTAGTAAACTTTCTCGAGAAAGTTTACTAATGAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010418.2-616s21c1
Sequence:CCGGGCGCTACTTCATTGCCTTGAACTCGAGTTCAAGGCAATGAAGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004667
HERC2 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-10169s1c1
Sequence:CCGGGCAAGTAATTCTAAGCCAAATCTCGAGATTTGGCTTAGAATTACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004667.2-15075s1c1
Sequence:CCGGCCAGAGGATATTTAAACCAAACTCGAGTTTGGTTTAAATATCCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-14532s1c1
Sequence:CCGGCGGACTCTACACAAGATTATTCTCGAGAATAATCTTGTGTAGAGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-12623s1c1
Sequence:CCGGCCTATGAAGATTGATTCTCTTCTCGAGAAGAGAATCAATCTTCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-3626s1c1
Sequence:CCGGCCTGGCATAATGGAGTCATTTCTCGAGAAATGACTCCATTATGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004667
HERC2 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-10169s1c1
Sequence:CCGGGCAAGTAATTCTAAGCCAAATCTCGAGATTTGGCTTAGAATTACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004667.2-15075s1c1
Sequence:CCGGCCAGAGGATATTTAAACCAAACTCGAGTTTGGTTTAAATATCCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-14532s1c1
Sequence:CCGGCGGACTCTACACAAGATTATTCTCGAGAATAATCTTGTGTAGAGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-12623s1c1
Sequence:CCGGCCTATGAAGATTGATTCTCTTCTCGAGAAGAGAATCAATCTTCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-3626s1c1
Sequence:CCGGCCTGGCATAATGGAGTCATTTCTCGAGAAATGACTCCATTATGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004667
HERC2 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-10169s1c1
Sequence:CCGGGCAAGTAATTCTAAGCCAAATCTCGAGATTTGGCTTAGAATTACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004667.2-15075s1c1
Sequence:CCGGCCAGAGGATATTTAAACCAAACTCGAGTTTGGTTTAAATATCCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-14532s1c1
Sequence:CCGGCGGACTCTACACAAGATTATTCTCGAGAATAATCTTGTGTAGAGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-12623s1c1
Sequence:CCGGCCTATGAAGATTGATTCTCTTCTCGAGAAGAGAATCAATCTTCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004667.2-3626s1c1
Sequence:CCGGCCTGGCATAATGGAGTCATTTCTCGAGAAATGACTCCATTATGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)