EMAIL THIS PAGE TO A FRIEND

HERC2P2

hect domain and RLD 2 pseudogene 2

12 Gene Product Result for
Synonyms: D15F37S3 MN7
Species: Human HERC2P2(400322)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024681 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002824 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377134 predicted 784
2 SASI_Hs02_00377135 predicted 4286
3 SASI_Hs02_00377136 predicted 5258
4 SASI_Hs02_00377137 predicted 5175
5 SASI_Hs02_00377138 predicted 470
6 SASI_Hs02_00377139 predicted 5144
7 SASI_Hs02_00377140 predicted 4886
8 SASI_Hs02_00377141 predicted 5155
9 SASI_Hs02_00377142 predicted 5345
10 SASI_Hs02_00377143 predicted 5416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024681
HERC2P2 MISSION shRNA Bacterial Glycerol Stock
hect domain and RLD 2 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024681.1-5708s1c1
Sequence:CCGGCCTGCTTCTTTAACTTGATAACTCGAGTTATCAAGTTAAAGAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-1193s1c1
Sequence:CCGGGCTGTTATGTTGCCTCTTAAACTCGAGTTTAAGAGGCAACATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-2823s1c1
Sequence:CCGGGCTGAGATCATGCAGAGTGAACTCGAGTTCACTCTGCATGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-1457s1c1
Sequence:CCGGCCTCTCTATAATGTCTAAGTTCTCGAGAACTTAGACATTATAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-4554s1c1
Sequence:CCGGGCTGTATATGTGAGAGAGAATCTCGAGATTCTCTCTCACATATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024681
HERC2P2 MISSION shRNA shRNA Plasmid DNA
hect domain and RLD 2 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024681.1-5708s1c1
Sequence:CCGGCCTGCTTCTTTAACTTGATAACTCGAGTTATCAAGTTAAAGAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-1193s1c1
Sequence:CCGGGCTGTTATGTTGCCTCTTAAACTCGAGTTTAAGAGGCAACATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-2823s1c1
Sequence:CCGGGCTGAGATCATGCAGAGTGAACTCGAGTTCACTCTGCATGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-1457s1c1
Sequence:CCGGCCTCTCTATAATGTCTAAGTTCTCGAGAACTTAGACATTATAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-4554s1c1
Sequence:CCGGGCTGTATATGTGAGAGAGAATCTCGAGATTCTCTCTCACATATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024681
HERC2P2 MISSION shRNA Lentiviral Transduction Particles
hect domain and RLD 2 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024681.1-5708s1c1
Sequence:CCGGCCTGCTTCTTTAACTTGATAACTCGAGTTATCAAGTTAAAGAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-1193s1c1
Sequence:CCGGGCTGTTATGTTGCCTCTTAAACTCGAGTTTAAGAGGCAACATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-2823s1c1
Sequence:CCGGGCTGAGATCATGCAGAGTGAACTCGAGTTCACTCTGCATGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-1457s1c1
Sequence:CCGGCCTCTCTATAATGTCTAAGTTCTCGAGAACTTAGACATTATAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024681.1-4554s1c1
Sequence:CCGGGCTGTATATGTGAGAGAGAATCTCGAGATTCTCTCTCACATATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)