EMAIL THIS PAGE TO A FRIEND

HERC2P3

hect domain and RLD 2 pseudogene 3

7 Gene Product Result for
Synonyms: D15F37S4
Species: Human HERC2P3(283755)
UniProtKB ID: Q9BVR0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024682 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127371 MISSION® esiRNA esiRNA human HERC2P3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024682 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205521 predicted 741
2 SASI_Hs01_00205522 predicted 3421
3 SASI_Hs01_00205523 predicted 3500
4 SASI_Hs01_00205524 predicted 4088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024682
HERC2P3 MISSION shRNA Bacterial Glycerol Stock
hect domain and RLD 2 pseudogene 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3798s1c1
Sequence:CCGGCCAGCAGTTGAAGCTATACATCTCGAGATGTATAGCTTCAACTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-1270s1c1
Sequence:CCGGGCACTTGGTATTGAGCAAGTACTCGAGTACTTGCTCAATACCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3639s1c1
Sequence:CCGGCGTGGCCTTTAATGTGAACAACTCGAGTTGTTCACATTAAAGGCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3051s1c1
Sequence:CCGGGCAGATCTTAGCTGTGCATTTCTCGAGAAATGCACAGCTAAGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-2181s1c1
Sequence:CCGGGCAAACCATCACCAATGAGAACTCGAGTTCTCATTGGTGATGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024682
HERC2P3 MISSION shRNA shRNA Plasmid DNA
hect domain and RLD 2 pseudogene 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3798s1c1
Sequence:CCGGCCAGCAGTTGAAGCTATACATCTCGAGATGTATAGCTTCAACTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-1270s1c1
Sequence:CCGGGCACTTGGTATTGAGCAAGTACTCGAGTACTTGCTCAATACCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3639s1c1
Sequence:CCGGCGTGGCCTTTAATGTGAACAACTCGAGTTGTTCACATTAAAGGCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3051s1c1
Sequence:CCGGGCAGATCTTAGCTGTGCATTTCTCGAGAAATGCACAGCTAAGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-2181s1c1
Sequence:CCGGGCAAACCATCACCAATGAGAACTCGAGTTCTCATTGGTGATGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024682
HERC2P3 MISSION shRNA Lentiviral Transduction Particles
hect domain and RLD 2 pseudogene 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3798s1c1
Sequence:CCGGCCAGCAGTTGAAGCTATACATCTCGAGATGTATAGCTTCAACTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-1270s1c1
Sequence:CCGGGCACTTGGTATTGAGCAAGTACTCGAGTACTTGCTCAATACCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3639s1c1
Sequence:CCGGCGTGGCCTTTAATGTGAACAACTCGAGTTGTTCACATTAAAGGCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-3051s1c1
Sequence:CCGGGCAGATCTTAGCTGTGCATTTCTCGAGAAATGCACAGCTAAGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024682.1-2181s1c1
Sequence:CCGGGCAAACCATCACCAATGAGAACTCGAGTTCTCATTGGTGATGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)