EMAIL THIS PAGE TO A FRIEND

HERC2P9

hect domain and RLD 2 pseudogene 9

12 Gene Product Result for
Species: Human HERC2P9(440248)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199045 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023131 predicted 1187
2 SASI_Hs01_00023132 predicted 2446
3 SASI_Hs01_00023133 predicted 460
4 SASI_Hs01_00023134 predicted 1465
5 SASI_Hs01_00023135 predicted 3023
6 SASI_Hs01_00023136 predicted 1825
7 SASI_Hs01_00023137 predicted 983
8 SASI_Hs01_00023138 predicted 1191
9 SASI_Hs01_00023139 predicted 2079
10 SASI_Hs01_00023140 predicted 2563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199045
HERC2P9 MISSION shRNA Bacterial Glycerol Stock
hect domain and RLD 2 pseudogene 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199045.1-4484s1c1
Sequence:CCGGCCAGGCATACATTTGGCAGAACTCGAGTTCTGCCAAATGTATGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-1238s1c1
Sequence:CCGGGCTCAGAAGATAATTCGAGAACTCGAGTTCTCGAATTATCTTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-785s1c1
Sequence:CCGGGCAGACAACAACATTCAGGATCTCGAGATCCTGAATGTTGTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-1894s1c1
Sequence:CCGGGCAAACCATCACCAATGAGAACTCGAGTTCTCATTGGTGATGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-2904s1c1
Sequence:CCGGCGTTACTCAGAGGCCCAGTTACTCGAGTAACTGGGCCTCTGAGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199045
HERC2P9 MISSION shRNA shRNA Plasmid DNA
hect domain and RLD 2 pseudogene 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199045.1-4484s1c1
Sequence:CCGGCCAGGCATACATTTGGCAGAACTCGAGTTCTGCCAAATGTATGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-1238s1c1
Sequence:CCGGGCTCAGAAGATAATTCGAGAACTCGAGTTCTCGAATTATCTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-785s1c1
Sequence:CCGGGCAGACAACAACATTCAGGATCTCGAGATCCTGAATGTTGTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-1894s1c1
Sequence:CCGGGCAAACCATCACCAATGAGAACTCGAGTTCTCATTGGTGATGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-2904s1c1
Sequence:CCGGCGTTACTCAGAGGCCCAGTTACTCGAGTAACTGGGCCTCTGAGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199045
HERC2P9 MISSION shRNA Lentiviral Transduction Particles
hect domain and RLD 2 pseudogene 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199045.1-4484s1c1
Sequence:CCGGCCAGGCATACATTTGGCAGAACTCGAGTTCTGCCAAATGTATGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-1238s1c1
Sequence:CCGGGCTCAGAAGATAATTCGAGAACTCGAGTTCTCGAATTATCTTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-785s1c1
Sequence:CCGGGCAGACAACAACATTCAGGATCTCGAGATCCTGAATGTTGTTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-1894s1c1
Sequence:CCGGGCAAACCATCACCAATGAGAACTCGAGTTCTCATTGGTGATGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199045.1-2904s1c1
Sequence:CCGGCGTTACTCAGAGGCCCAGTTACTCGAGTAACTGGGCCTCTGAGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)