EMAIL THIS PAGE TO A FRIEND

HERC4

HECT and RLD domain containing E3 ubiquitin protein ligase 4

124 Gene Product Result for
UniProtKB ID: Q5GLZ8, Q5GC98, Q5GC99, Q5GCA0, Q8IXP9, Q9HCH9
Gene ID:
Human(26091) Summary: HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]
Mouse(67345) hect domain and RLD 4
Rat(309758) HECT and RLD domain containing E3 ubiquitin protein ligase 4
sheep(101103532) HECT and RLD domain containing E3 ubiquitin protein ligase 4
Domestic Rabbit(100348847) HECT and RLD domain containing E3 ubiquitin protein ligase 4
domestic guinea pig(100717289) HECT and RLD domain containing E3 ubiquitin protein ligase 4
naked mole-rat(101725893) HECT and RLD domain containing E3 ubiquitin protein ligase 4
Zebrafish(557513) hect domain and RLD 4
dog(479225) HECT and RLD domain containing E3 ubiquitin protein ligase 4
chicken(423683) HECT and RLD domain containing E3 ubiquitin protein ligase 4
cow(533336) HECT and RLD domain containing E3 ubiquitin protein ligase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015601 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017972 Rosetta Predictions human pricing
NM_015601 Rosetta Predictions human pricing
NM_022079 Rosetta Predictions human pricing
NM_001012074 Rosetta Predictions rat pricing
XM_574749 Rosetta Predictions rat pricing
NM_026101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119775 predicted 495
2 SASI_Hs01_00119776 predicted 497
3 SASI_Hs01_00119777 predicted 600
4 SASI_Hs01_00119778 predicted 826
5 SASI_Hs01_00119779 predicted 411
6 SASI_Hs01_00119780 predicted 587
7 SASI_Hs01_00119781 predicted 741
8 SASI_Hs01_00119782 predicted 376
9 SASI_Hs01_00119783 predicted 594
10 SASI_Hs01_00119784 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348183 predicted 706
2 SASI_Hs01_00090067 predicted 1950
3 SASI_Hs02_00348184 predicted 810
4 SASI_Hs01_00090070 predicted 3085
5 SASI_Hs01_00090072 predicted 3214
6 SASI_Hs01_00090073 predicted 2682
7 SASI_Hs02_00348185 predicted 956
8 SASI_Hs02_00348186 predicted 600
9 SASI_Hs01_00090075 predicted 1545
10 SASI_Hs01_00090076 predicted 1792
11 SASI_Hs01_00090068 predicted 2604
12 SASI_Hs01_00090069 predicted 1551
13 SASI_Hs01_00090071 predicted 3148
14 SASI_Hs01_00090074 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355450 predicted 709
2 SASI_Hs01_00047115 predicted 1945
3 SASI_Hs02_00355451 predicted 809
4 SASI_Hs01_00047118 predicted 3110
5 SASI_Hs01_00047120 predicted 3236
6 SASI_Hs01_00047121 predicted 2699
7 SASI_Hs02_00355452 predicted 958
8 SASI_Hs02_00355453 predicted 596
9 SASI_Hs01_00047123 predicted 1540
10 SASI_Hs01_00047124 predicted 1796
11 SASI_Hs01_00047116 predicted 2660
12 SASI_Hs01_00047117 predicted 1578
13 SASI_Hs01_00047119 predicted 3196
14 SASI_Hs01_00047122 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103086 predicted 2378
2 SASI_Rn01_00103087 predicted 2806
3 SASI_Rn02_00200187 predicted 795
4 SASI_Rn01_00103088 predicted 717
5 SASI_Rn02_00200188 predicted 3405
6 SASI_Rn01_00103089 predicted 2250
7 SASI_Rn01_00103090 predicted 2217
8 SASI_Rn02_00200189 predicted 2536
9 SASI_Rn01_00103092 predicted 456
10 SASI_Rn01_00103094 predicted 552
11 SASI_Rn01_00103091 predicted 2715
12 SASI_Rn01_00103093 predicted 1333
13 SASI_Rn01_00103095 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176239 predicted 2203
2 SASI_Rn01_00176240 predicted 2639
3 SASI_Rn01_00176241 predicted 545
4 SASI_Rn01_00176242 predicted 2070
5 SASI_Rn01_00176243 predicted 2047
6 SASI_Rn01_00176244 predicted 2544
7 SASI_Rn01_00176245 predicted 2362
8 SASI_Rn01_00176246 predicted 1167
9 SASI_Rn01_00176247 predicted 382
10 SASI_Rn01_00176248 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105682 predicted 1675
2 SASI_Mm01_00105683 predicted 1612
3 SASI_Mm01_00105684 predicted 2652
4 SASI_Mm01_00105685 predicted 656
5 SASI_Mm01_00105686 predicted 3498
6 SASI_Mm01_00105687 predicted 683
7 SASI_Mm01_00105688 predicted 2106
8 SASI_Mm01_00105689 predicted 2365
9 SASI_Mm01_00105690 predicted 2227
10 SASI_Mm01_00105691 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015601
VALIDATED
HERC4 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015601.3-3824s21c1
Sequence:CCGGTTTGGCCTGCAATAGTCATTTCTCGAGAAATGACTATTGCAGGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-1639s21c1
Sequence:CCGGTTAGCAATGATGATCACTATACTCGAGTATAGTGATCATCATTGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-1358s21c1
Sequence:CCGGTGGGCAGTGTCTACCAGATATCTCGAGATATCTGGTAGACACTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015601.3-3537s21c1
Sequence:CCGGCAAGGTGACAGAGGTACTATTCTCGAGAATAGTACCTCTGTCACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2688s21c1
Sequence:CCGGATCTGTGGCTTAGCAATTTATCTCGAGATAAATTGCTAAGCCACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-592s21c1
Sequence:CCGGCTCATACGTTAGCGCTAAATGCTCGAGCATTTAGCGCTAACGTATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2491s21c1
Sequence:CCGGAGAAGCCACTCAAGGTTATATCTCGAGATATAACCTTGAGTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2595s21c1
Sequence:CCGGTACGGCATGTTTAGGTATTATCTCGAGATAATACCTAAACATGCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-867s1c1
Sequence:CCGGCGCAACAAGTTTGGTCAGCTACTCGAGTAGCTGACCAAACTTGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-2136s1c1
Sequence:CCGGGCCTATGGAATGTTGGCAGATCTCGAGATCTGCCAACATTCCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-1208s1c1
Sequence:CCGGCGGTTCAACAAGCAACAGGAACTCGAGTTCCTGTTGCTTGTTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-2320s1c1
Sequence:CCGGGCTTAATTCTAGTGGTGCGTACTCGAGTACGCACCACTAGAATTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015601.2-2682s1c1
Sequence:CCGGCCATCCTTGGATGATTTGAAACTCGAGTTTCAAATCATCCAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015601
VALIDATED
HERC4 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015601.3-3824s21c1
Sequence:CCGGTTTGGCCTGCAATAGTCATTTCTCGAGAAATGACTATTGCAGGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-1639s21c1
Sequence:CCGGTTAGCAATGATGATCACTATACTCGAGTATAGTGATCATCATTGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-1358s21c1
Sequence:CCGGTGGGCAGTGTCTACCAGATATCTCGAGATATCTGGTAGACACTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015601.3-3537s21c1
Sequence:CCGGCAAGGTGACAGAGGTACTATTCTCGAGAATAGTACCTCTGTCACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2688s21c1
Sequence:CCGGATCTGTGGCTTAGCAATTTATCTCGAGATAAATTGCTAAGCCACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-592s21c1
Sequence:CCGGCTCATACGTTAGCGCTAAATGCTCGAGCATTTAGCGCTAACGTATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2491s21c1
Sequence:CCGGAGAAGCCACTCAAGGTTATATCTCGAGATATAACCTTGAGTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2595s21c1
Sequence:CCGGTACGGCATGTTTAGGTATTATCTCGAGATAATACCTAAACATGCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-867s1c1
Sequence:CCGGCGCAACAAGTTTGGTCAGCTACTCGAGTAGCTGACCAAACTTGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-2136s1c1
Sequence:CCGGGCCTATGGAATGTTGGCAGATCTCGAGATCTGCCAACATTCCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-1208s1c1
Sequence:CCGGCGGTTCAACAAGCAACAGGAACTCGAGTTCCTGTTGCTTGTTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-2320s1c1
Sequence:CCGGGCTTAATTCTAGTGGTGCGTACTCGAGTACGCACCACTAGAATTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015601.2-2682s1c1
Sequence:CCGGCCATCCTTGGATGATTTGAAACTCGAGTTTCAAATCATCCAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015601
VALIDATED
HERC4 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015601.3-3824s21c1
Sequence:CCGGTTTGGCCTGCAATAGTCATTTCTCGAGAAATGACTATTGCAGGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-1639s21c1
Sequence:CCGGTTAGCAATGATGATCACTATACTCGAGTATAGTGATCATCATTGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-1358s21c1
Sequence:CCGGTGGGCAGTGTCTACCAGATATCTCGAGATATCTGGTAGACACTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015601.3-3537s21c1
Sequence:CCGGCAAGGTGACAGAGGTACTATTCTCGAGAATAGTACCTCTGTCACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2688s21c1
Sequence:CCGGATCTGTGGCTTAGCAATTTATCTCGAGATAAATTGCTAAGCCACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-592s21c1
Sequence:CCGGCTCATACGTTAGCGCTAAATGCTCGAGCATTTAGCGCTAACGTATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2491s21c1
Sequence:CCGGAGAAGCCACTCAAGGTTATATCTCGAGATATAACCTTGAGTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015601.3-2595s21c1
Sequence:CCGGTACGGCATGTTTAGGTATTATCTCGAGATAATACCTAAACATGCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-867s1c1
Sequence:CCGGCGCAACAAGTTTGGTCAGCTACTCGAGTAGCTGACCAAACTTGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-2136s1c1
Sequence:CCGGGCCTATGGAATGTTGGCAGATCTCGAGATCTGCCAACATTCCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-1208s1c1
Sequence:CCGGCGGTTCAACAAGCAACAGGAACTCGAGTTCCTGTTGCTTGTTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015601.2-2320s1c1
Sequence:CCGGGCTTAATTCTAGTGGTGCGTACTCGAGTACGCACCACTAGAATTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015601.2-2682s1c1
Sequence:CCGGCCATCCTTGGATGATTTGAAACTCGAGTTTCAAATCATCCAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026101
VALIDATED
HERC4 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026101.2-2362s21c1
Sequence:CCGGCCAGTGATCGAGTCTGTGAATCTCGAGATTCACAGACTCGATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026101.2-535s21c1
Sequence:CCGGGCCCAGAATATCGTAGCTGTTCTCGAGAACAGCTACGATATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-3607s21c1
Sequence:CCGGGTCCATCCTCATACAAGTATTCTCGAGAATACTTGTATGAGGATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-2571s21c1
Sequence:CCGGATACGGCATGTTTCGATATTACTCGAGTAATATCGAAACATGCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-1556s21c1
Sequence:CCGGCCAATGAGATAGATGGAACATCTCGAGATGTTCCATCTATCTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-535s1c1
Sequence:CCGGGCCCAGAATATCGTAGCTGTTCTCGAGAACAGCTACGATATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-1345s1c1
Sequence:CCGGCCACAAGATATTGGTTCTGAACTCGAGTTCAGAACCAATATCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026101.2-2362s1c1
Sequence:CCGGCCAGTGATCGAGTCTGTGAATCTCGAGATTCACAGACTCGATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-1556s1c1
Sequence:CCGGCCAATGAGATAGATGGAACATCTCGAGATGTTCCATCTATCTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-3063s1c1
Sequence:CCGGGCCTAATGAATTACAAGCTATCTCGAGATAGCTTGTAATTCATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026101
VALIDATED
HERC4 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026101.2-2362s21c1
Sequence:CCGGCCAGTGATCGAGTCTGTGAATCTCGAGATTCACAGACTCGATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026101.2-535s21c1
Sequence:CCGGGCCCAGAATATCGTAGCTGTTCTCGAGAACAGCTACGATATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-3607s21c1
Sequence:CCGGGTCCATCCTCATACAAGTATTCTCGAGAATACTTGTATGAGGATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-2571s21c1
Sequence:CCGGATACGGCATGTTTCGATATTACTCGAGTAATATCGAAACATGCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-1556s21c1
Sequence:CCGGCCAATGAGATAGATGGAACATCTCGAGATGTTCCATCTATCTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-535s1c1
Sequence:CCGGGCCCAGAATATCGTAGCTGTTCTCGAGAACAGCTACGATATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-1345s1c1
Sequence:CCGGCCACAAGATATTGGTTCTGAACTCGAGTTCAGAACCAATATCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026101.2-2362s1c1
Sequence:CCGGCCAGTGATCGAGTCTGTGAATCTCGAGATTCACAGACTCGATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-1556s1c1
Sequence:CCGGCCAATGAGATAGATGGAACATCTCGAGATGTTCCATCTATCTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-3063s1c1
Sequence:CCGGGCCTAATGAATTACAAGCTATCTCGAGATAGCTTGTAATTCATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026101
VALIDATED
HERC4 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026101.2-2362s21c1
Sequence:CCGGCCAGTGATCGAGTCTGTGAATCTCGAGATTCACAGACTCGATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026101.2-535s21c1
Sequence:CCGGGCCCAGAATATCGTAGCTGTTCTCGAGAACAGCTACGATATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-3607s21c1
Sequence:CCGGGTCCATCCTCATACAAGTATTCTCGAGAATACTTGTATGAGGATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-2571s21c1
Sequence:CCGGATACGGCATGTTTCGATATTACTCGAGTAATATCGAAACATGCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026101.2-1556s21c1
Sequence:CCGGCCAATGAGATAGATGGAACATCTCGAGATGTTCCATCTATCTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-535s1c1
Sequence:CCGGGCCCAGAATATCGTAGCTGTTCTCGAGAACAGCTACGATATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-1345s1c1
Sequence:CCGGCCACAAGATATTGGTTCTGAACTCGAGTTCAGAACCAATATCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026101.2-2362s1c1
Sequence:CCGGCCAGTGATCGAGTCTGTGAATCTCGAGATTCACAGACTCGATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-1556s1c1
Sequence:CCGGCCAATGAGATAGATGGAACATCTCGAGATGTTCCATCTATCTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026101.2-3063s1c1
Sequence:CCGGGCCTAATGAATTACAAGCTATCTCGAGATAGCTTGTAATTCATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)