EMAIL THIS PAGE TO A FRIEND

HERC5

HECT and RLD domain containing E3 ubiquitin protein ligase 5

30 Gene Product Result for
Synonyms: CEB1 CEBP1
UniProtKB ID: Q9UII4, B2RTQ1, Q69G20
Gene ID:
Human(51191) Summary: This gene is a member of the HERC family of ubiquitin ligases and encodes a protein with a HECT domain and five RCC1 repeats. Pro-inflammatory cytokines upregulate expression of this gene in endothelial cells. The protein localizes to the cytoplasm and perinuclear region and functions as an interferon-induced E3 protein ligase that mediates ISGylation of protein targets. The gene lies in a cluster of HERC family genes on chromosome 4. [provided by RefSeq, Jul 2008]
dog(478474) HECT and RLD domain containing E3 ubiquitin protein ligase 5
domestic cat(101098222) HECT and RLD domain containing E3 ubiquitin protein ligase 5
cow(514373) hect domain and RLD 5
Horse(100063774) HECT and RLD domain containing E3 ubiquitin protein ligase 5
domestic guinea pig(100717453) HECT and RLD domain containing E3 ubiquitin protein ligase 5
naked mole-rat(101725261) HECT and RLD domain containing E3 ubiquitin protein ligase 5
sheep(101119562) HECT and RLD domain containing E3 ubiquitin protein ligase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016323 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007021 MISSION® esiRNA esiRNA targeting human HERC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016323 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188201 predicted 1762
2 SASI_Hs01_00188202 predicted 2914
3 SASI_Hs02_00349262 predicted 2416
4 SASI_Hs01_00188203 predicted 2236
5 SASI_Hs01_00188204 predicted 1822
6 SASI_Hs02_00349263 predicted 1456
7 SASI_Hs01_00188208 predicted 2208
8 SASI_Hs02_00349264 predicted 868
9 SASI_Hs01_00188209 predicted 2353
10 SASI_Hs02_00349265 predicted 1528
11 SASI_Hs01_00188205 predicted 2705
12 SASI_Hs01_00188206 predicted 1463
13 SASI_Hs01_00188207 predicted 1134
14 SASI_Hs01_00188210 predicted 1900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016323
VALIDATED
HERC5 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-3349s1c1
Sequence:CCGGAGAGGGTTTACTGGCCGGTTACTCGAGTAACCGGCCAGTAAACCCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016323.x-1427s1c1
Sequence:CCGGGATGCCTGTTTATTTGGACTTCTCGAGAAGTCCAAATAAACAGGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-2788s1c1
Sequence:CCGGGCGACGAAGACATTATCAAATCTCGAGATTTGATAATGTCTTCGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-825s1c1
Sequence:CCGGGAAGGACTAGACAATCAGAAACTCGAGTTTCTGATTGTCTAGTCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016323.x-1794s1c1
Sequence:CCGGGCTGAGGAGAATGGTAATGTTCTCGAGAACATTACCATTCTCCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-968s21c1
Sequence:CCGGATGGGCAACTTGGTCATAATTCTCGAGAATTATGACCAAGTTGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016323.2-2828s21c1
Sequence:CCGGGCGACGAAGACATTATCAAATCTCGAGATTTGATAATGTCTTCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-865s21c1
Sequence:CCGGGAAGGACTAGACAATCAGAAACTCGAGTTTCTGATTGTCTAGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-2019s21c1
Sequence:CCGGTGTACAATGCTGCGTCATATTCTCGAGAATATGACGCAGCATTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-3389s21c1
Sequence:CCGGAGAGGGTTTACTGGCCGGTTACTCGAGTAACCGGCCAGTAAACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016323
VALIDATED
HERC5 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-3349s1c1
Sequence:CCGGAGAGGGTTTACTGGCCGGTTACTCGAGTAACCGGCCAGTAAACCCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016323.x-1427s1c1
Sequence:CCGGGATGCCTGTTTATTTGGACTTCTCGAGAAGTCCAAATAAACAGGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-2788s1c1
Sequence:CCGGGCGACGAAGACATTATCAAATCTCGAGATTTGATAATGTCTTCGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-825s1c1
Sequence:CCGGGAAGGACTAGACAATCAGAAACTCGAGTTTCTGATTGTCTAGTCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016323.x-1794s1c1
Sequence:CCGGGCTGAGGAGAATGGTAATGTTCTCGAGAACATTACCATTCTCCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-968s21c1
Sequence:CCGGATGGGCAACTTGGTCATAATTCTCGAGAATTATGACCAAGTTGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016323.2-2828s21c1
Sequence:CCGGGCGACGAAGACATTATCAAATCTCGAGATTTGATAATGTCTTCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-865s21c1
Sequence:CCGGGAAGGACTAGACAATCAGAAACTCGAGTTTCTGATTGTCTAGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-2019s21c1
Sequence:CCGGTGTACAATGCTGCGTCATATTCTCGAGAATATGACGCAGCATTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-3389s21c1
Sequence:CCGGAGAGGGTTTACTGGCCGGTTACTCGAGTAACCGGCCAGTAAACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016323
VALIDATED
HERC5 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-3349s1c1
Sequence:CCGGAGAGGGTTTACTGGCCGGTTACTCGAGTAACCGGCCAGTAAACCCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016323.x-1427s1c1
Sequence:CCGGGATGCCTGTTTATTTGGACTTCTCGAGAAGTCCAAATAAACAGGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-2788s1c1
Sequence:CCGGGCGACGAAGACATTATCAAATCTCGAGATTTGATAATGTCTTCGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016323.x-825s1c1
Sequence:CCGGGAAGGACTAGACAATCAGAAACTCGAGTTTCTGATTGTCTAGTCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016323.x-1794s1c1
Sequence:CCGGGCTGAGGAGAATGGTAATGTTCTCGAGAACATTACCATTCTCCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-968s21c1
Sequence:CCGGATGGGCAACTTGGTCATAATTCTCGAGAATTATGACCAAGTTGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016323.2-2828s21c1
Sequence:CCGGGCGACGAAGACATTATCAAATCTCGAGATTTGATAATGTCTTCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-865s21c1
Sequence:CCGGGAAGGACTAGACAATCAGAAACTCGAGTTTCTGATTGTCTAGTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-2019s21c1
Sequence:CCGGTGTACAATGCTGCGTCATATTCTCGAGAATATGACGCAGCATTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016323.2-3389s21c1
Sequence:CCGGAGAGGGTTTACTGGCCGGTTACTCGAGTAACCGGCCAGTAAACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)