EMAIL THIS PAGE TO A FRIEND

HERC6

HECT and RLD domain containing E3 ubiquitin protein ligase family member 6

108 Gene Product Result for
Gene ID:
Human(55008) Summary: HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]
Mouse(67138) hect domain and RLD 6
Rat(362376) HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
sheep(101103321) HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
domestic guinea pig(100717178) HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
domestic cat(101098457) HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
cow(527520) hect domain and RLD 6
Horse(100063706) HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
dog(609237) HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017912 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013000 Rosetta Predictions human pricing
NM_001013002 Rosetta Predictions human pricing
NM_001013005 Rosetta Predictions human pricing
NM_017912 Rosetta Predictions human pricing
XM_001064216 Rosetta Predictions rat pricing
XM_342700 Rosetta Predictions rat pricing
XM_001478484 Rosetta Predictions mouse pricing
XM_001478497 Rosetta Predictions mouse pricing
XM_907983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013804 predicted 838
2 SASI_Hs01_00013805 predicted 409
3 SASI_Hs01_00013806 predicted 393
4 SASI_Hs01_00013807 predicted 1042
5 SASI_Hs01_00013808 predicted 929
6 SASI_Hs01_00013809 predicted 1080
7 SASI_Hs01_00013810 predicted 1061
8 SASI_Hs01_00013811 predicted 1227
9 SASI_Hs01_00013812 predicted 960
10 SASI_Hs01_00013813 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234305 predicted 830
2 SASI_Hs01_00234306 predicted 2778
3 SASI_Hs01_00234307 predicted 2885
4 SASI_Hs01_00234308 predicted 400
5 SASI_Hs01_00234309 predicted 400
6 SASI_Hs01_00234310 predicted 2843
7 SASI_Hs01_00234311 predicted 2599
8 SASI_Hs01_00234312 predicted 2735
9 SASI_Hs01_00234313 predicted 2973
10 SASI_Hs01_00234314 predicted 2823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177289 predicted 834
2 SASI_Hs01_00177290 predicted 405
3 SASI_Hs01_00177291 predicted 396
4 SASI_Hs01_00177292 predicted 1043
5 SASI_Hs01_00177293 predicted 929
6 SASI_Hs01_00177294 predicted 1065
7 SASI_Hs01_00177295 predicted 1215
8 SASI_Hs01_00177296 predicted 1365
9 SASI_Hs01_00177297 predicted 966
10 SASI_Hs01_00177298 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014183 predicted 825
2 SASI_Hs01_00014185 predicted 2990
3 SASI_Hs02_00350888 predicted 3190
4 SASI_Hs01_00014186 predicted 401
5 SASI_Hs02_00350889 predicted 923
6 SASI_Hs01_00014187 predicted 388
7 SASI_Hs02_00350890 predicted 1206
8 SASI_Hs02_00350891 predicted 2185
9 SASI_Hs01_00014188 predicted 2949
10 SASI_Hs02_00350892 predicted 1938
11 SASI_Hs01_00014184 predicted 2885
12 SASI_Hs01_00014189 predicted 2714
13 SASI_Hs01_00014190 predicted 2835
14 SASI_Hs01_00014191 predicted 3081
15 SASI_Hs01_00014192 predicted 2932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309687 predicted 2091
2 SASI_Rn02_00309688 predicted 2843
3 SASI_Rn02_00309689 predicted 566
4 SASI_Rn02_00309690 predicted 317
5 SASI_Rn02_00309691 predicted 2452
6 SASI_Rn02_00309692 predicted 3190
7 SASI_Rn02_00309693 predicted 2745
8 SASI_Rn02_00309694 predicted 2805
9 SASI_Rn02_00309695 predicted 298
10 SASI_Rn02_00309696 predicted 1830
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394681 predicted 235
2 SASI_Rn02_00394682 predicted 361
3 SASI_Rn02_00394683 predicted 324
4 SASI_Rn02_00394684 predicted 355
5 SASI_Rn02_00394685 predicted 365
6 SASI_Rn02_00394686 predicted 293
7 SASI_Rn02_00394687 predicted 230
8 SASI_Rn02_00394688 predicted 239
9 SASI_Rn02_00394689 predicted 303
10 SASI_Rn02_00394690 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00402961 predicted 1241
2 SASI_Mm02_00402962 predicted 2556
3 SASI_Mm02_00402963 predicted 1825
4 SASI_Mm02_00402964 predicted 815
5 SASI_Mm02_00402965 predicted 2298
6 SASI_Mm02_00402966 predicted 1110
7 SASI_Mm02_00402967 predicted 1121
8 SASI_Mm02_00402968 predicted 904
9 SASI_Mm02_00402969 predicted 2418
10 SASI_Mm02_00402970 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00403044 predicted 1241
2 SASI_Mm02_00403045 predicted 2588
3 SASI_Mm02_00403046 predicted 1821
4 SASI_Mm02_00403047 predicted 2666
5 SASI_Mm02_00403048 predicted 818
6 SASI_Mm02_00403049 predicted 2332
7 SASI_Mm02_00403050 predicted 1657
8 SASI_Mm02_00403051 predicted 901
9 SASI_Mm02_00403052 predicted 2445
10 SASI_Mm02_00403053 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433675 predicted 1235
2 SASI_Mm02_00433676 predicted 2315
3 SASI_Mm02_00433677 predicted 1544
4 SASI_Mm02_00433678 predicted 2386
5 SASI_Mm02_00433679 predicted 812
6 SASI_Mm02_00433680 predicted 2058
7 SASI_Mm02_00433681 predicted 1381
8 SASI_Mm02_00433682 predicted 898
9 SASI_Mm02_00433683 predicted 2178
10 SASI_Mm02_00433684 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017912
VALIDATED
HERC6 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-1072s1c1
Sequence:CCGGGCTGAAGACTTCGTGGATGTTCTCGAGAACATCCACGAAGTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-3411s1c1
Sequence:CCGGGCATAAGGTATCAAACCACATCTCGAGATGTGGTTTGATACCTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-3487s1c1
Sequence:CCGGCCAGGACATTCATTTGCATAACTCGAGTTATGCAAATGAATGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017912.2-2113s1c1
Sequence:CCGGCGTCAATTAAGTCAAGCTGAACTCGAGTTCAGCTTGACTTAATTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-2217s1c1
Sequence:CCGGCCACTGTATGTTTGAAGAGATCTCGAGATCTCTTCAAACATACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-2992s1c1
Sequence:CCGGCCAACATCAATAACTTGTCATCTCGAGATGACAAGTTATTGATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-1608s1c1
Sequence:CCGGCCTAAAGAAGTGTTGGGCATTCTCGAGAATGCCCAACACTTCTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017912
VALIDATED
HERC6 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-1072s1c1
Sequence:CCGGGCTGAAGACTTCGTGGATGTTCTCGAGAACATCCACGAAGTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-3411s1c1
Sequence:CCGGGCATAAGGTATCAAACCACATCTCGAGATGTGGTTTGATACCTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-3487s1c1
Sequence:CCGGCCAGGACATTCATTTGCATAACTCGAGTTATGCAAATGAATGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017912.2-2113s1c1
Sequence:CCGGCGTCAATTAAGTCAAGCTGAACTCGAGTTCAGCTTGACTTAATTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-2217s1c1
Sequence:CCGGCCACTGTATGTTTGAAGAGATCTCGAGATCTCTTCAAACATACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-2992s1c1
Sequence:CCGGCCAACATCAATAACTTGTCATCTCGAGATGACAAGTTATTGATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-1608s1c1
Sequence:CCGGCCTAAAGAAGTGTTGGGCATTCTCGAGAATGCCCAACACTTCTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017912
VALIDATED
HERC6 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-1072s1c1
Sequence:CCGGGCTGAAGACTTCGTGGATGTTCTCGAGAACATCCACGAAGTCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-3411s1c1
Sequence:CCGGGCATAAGGTATCAAACCACATCTCGAGATGTGGTTTGATACCTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-3487s1c1
Sequence:CCGGCCAGGACATTCATTTGCATAACTCGAGTTATGCAAATGAATGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017912.2-2113s1c1
Sequence:CCGGCGTCAATTAAGTCAAGCTGAACTCGAGTTCAGCTTGACTTAATTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017912.2-2217s1c1
Sequence:CCGGCCACTGTATGTTTGAAGAGATCTCGAGATCTCTTCAAACATACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-2992s1c1
Sequence:CCGGCCAACATCAATAACTTGTCATCTCGAGATGACAAGTTATTGATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017912.2-1608s1c1
Sequence:CCGGCCTAAAGAAGTGTTGGGCATTCTCGAGAATGCCCAACACTTCTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)