EMAIL THIS PAGE TO A FRIEND

HERPUD2

HERPUD family member 2

100 Gene Product Result for
UniProtKB ID: Q9BSE4, A4D1Y8, Q9H6F9
Gene ID:
Mouse(80517) HERPUD family member 2
Rat(300463) HERPUD family member 2
sheep(101117411) HERPUD family member 2
domestic guinea pig(100713371) HERPUD family member 2
naked mole-rat(101724143) HERPUD family member 2
Zebrafish(393157) HERPUD family member 2
chicken(420742) HERPUD family member 2
cow(512265) HERPUD family member 2
domestic cat(101093510) HERPUD family member 2
dog(475283) HERPUD family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004171 MISSION® esiRNA esiRNA targeting human HERPUD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022373 Rosetta Predictions human pricing
NM_001024988 Rosetta Predictions rat pricing
NM_020586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161125 predicted 721
2 SASI_Hs01_00161126 predicted 777
3 SASI_Hs01_00161128 predicted 1523
4 SASI_Hs01_00161129 predicted 1497
5 SASI_Hs01_00161130 predicted 1734
6 SASI_Hs01_00161131 predicted 1248
7 SASI_Hs01_00161132 predicted 1329
8 SASI_Hs02_00355677 predicted 979
9 SASI_Hs02_00355678 predicted 946
10 SASI_Hs01_00161133 predicted 780
11 SASI_Hs01_00161127 predicted 1234
12 SASI_Hs01_00161134 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046578 predicted 660
2 SASI_Rn01_00046579 predicted 940
3 SASI_Rn01_00046580 predicted 457
4 SASI_Rn01_00046581 predicted 709
5 SASI_Rn01_00046583 predicted 562
6 SASI_Rn01_00046584 predicted 511
7 SASI_Rn01_00046585 predicted 1010
8 SASI_Rn02_00202870 predicted 1354
9 SASI_Rn01_00046586 predicted 357
10 SASI_Rn01_00046587 predicted 928
11 SASI_Rn01_00046582 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137074 predicted 730
2 SASI_Mm02_00325672 predicted 1277
3 SASI_Mm01_00137075 predicted 1583
4 SASI_Mm01_00137076 predicted 1065
5 SASI_Mm01_00137077 predicted 841
6 SASI_Mm01_00137078 predicted 1614
7 SASI_Mm01_00137079 predicted 1281
8 SASI_Mm01_00137080 predicted 1625
9 SASI_Mm01_00137081 predicted 1216
10 SASI_Mm01_00137082 predicted 1660
11 SASI_Mm01_00137083 predicted 1486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022373
VALIDATED
HERPUD2 MISSION shRNA Bacterial Glycerol Stock
HERPUD family member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022373.4-774s21c1
Sequence:CCGGACGCATCTATCTAACGTTTACCTCGAGGTAAACGTTAGATAGATGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022373.4-2114s21c1
Sequence:CCGGTCTTCCAGGTGTTACTCATTTCTCGAGAAATGAGTAACACCTGGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1682s1c1
Sequence:CCGGCTTATGGATGATGGGCTTGAACTCGAGTTCAAGCCCATCATCCATAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1475s1c1
Sequence:CCGGGCGATTCTCCTTAGCATTGTACTCGAGTACAATGCTAAGGAGAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1284s1c1
Sequence:CCGGCTACTACTTCACAGCCTCTAACTCGAGTTAGAGGCTGTGAAGTAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1991s1c1
Sequence:CCGGGCACGAATGGACTACTAAATACTCGAGTATTTAGTAGTCCATTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-648s1c1
Sequence:CCGGCCCTCATCATTAAAGCACCGACTCGAGTCGGTGCTTTAATGATGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022373
VALIDATED
HERPUD2 MISSION shRNA shRNA Plasmid DNA
HERPUD family member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022373.4-774s21c1
Sequence:CCGGACGCATCTATCTAACGTTTACCTCGAGGTAAACGTTAGATAGATGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022373.4-2114s21c1
Sequence:CCGGTCTTCCAGGTGTTACTCATTTCTCGAGAAATGAGTAACACCTGGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1682s1c1
Sequence:CCGGCTTATGGATGATGGGCTTGAACTCGAGTTCAAGCCCATCATCCATAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1475s1c1
Sequence:CCGGGCGATTCTCCTTAGCATTGTACTCGAGTACAATGCTAAGGAGAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1284s1c1
Sequence:CCGGCTACTACTTCACAGCCTCTAACTCGAGTTAGAGGCTGTGAAGTAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1991s1c1
Sequence:CCGGGCACGAATGGACTACTAAATACTCGAGTATTTAGTAGTCCATTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-648s1c1
Sequence:CCGGCCCTCATCATTAAAGCACCGACTCGAGTCGGTGCTTTAATGATGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022373
VALIDATED
HERPUD2 MISSION shRNA Lentiviral Transduction Particles
HERPUD family member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022373.4-774s21c1
Sequence:CCGGACGCATCTATCTAACGTTTACCTCGAGGTAAACGTTAGATAGATGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022373.4-2114s21c1
Sequence:CCGGTCTTCCAGGTGTTACTCATTTCTCGAGAAATGAGTAACACCTGGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1682s1c1
Sequence:CCGGCTTATGGATGATGGGCTTGAACTCGAGTTCAAGCCCATCATCCATAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1475s1c1
Sequence:CCGGGCGATTCTCCTTAGCATTGTACTCGAGTACAATGCTAAGGAGAATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1284s1c1
Sequence:CCGGCTACTACTTCACAGCCTCTAACTCGAGTTAGAGGCTGTGAAGTAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-1991s1c1
Sequence:CCGGGCACGAATGGACTACTAAATACTCGAGTATTTAGTAGTCCATTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022373.x-648s1c1
Sequence:CCGGCCCTCATCATTAAAGCACCGACTCGAGTCGGTGCTTTAATGATGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020586
HERPUD2 MISSION shRNA Bacterial Glycerol Stock
HERPUD family member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1673s21c1
Sequence:CCGGCGTCCTCCTCAGCATCGTATACTCGAGTATACGATGCTGAGGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020586.2-2079s21c1
Sequence:CCGGCGGTTTAAATAACAGTGCAATCTCGAGATTGCACTGTTATTTAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1274s21c1
Sequence:CCGGCCAGAGTCATCAGTTTCCATACTCGAGTATGGAAACTGATGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-875s21c1
Sequence:CCGGATACAGTGACCAGACTATTAGCTCGAGCTAATAGTCTGGTCACTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-745s1c1
Sequence:CCGGCCCTAGCAAACCATTGACAAACTCGAGTTTGTCAATGGTTTGCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-1069s1c1
Sequence:CCGGCCAGAGTCATCAGTTTCCATACTCGAGTATGGAAACTGATGACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-644s1c1
Sequence:CCGGCTCATCATTAAAGCACCGAATCTCGAGATTCGGTGCTTTAATGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1821s21c1
Sequence:CCGGGCTAACAATGACGGGCATAATCTCGAGATTATGCCCGTCATTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020586.1-1874s1c1
Sequence:CCGGCGGTTTAAATAACAGTGCAATCTCGAGATTGCACTGTTATTTAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020586
HERPUD2 MISSION shRNA shRNA Plasmid DNA
HERPUD family member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1673s21c1
Sequence:CCGGCGTCCTCCTCAGCATCGTATACTCGAGTATACGATGCTGAGGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020586.2-2079s21c1
Sequence:CCGGCGGTTTAAATAACAGTGCAATCTCGAGATTGCACTGTTATTTAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1274s21c1
Sequence:CCGGCCAGAGTCATCAGTTTCCATACTCGAGTATGGAAACTGATGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-875s21c1
Sequence:CCGGATACAGTGACCAGACTATTAGCTCGAGCTAATAGTCTGGTCACTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-745s1c1
Sequence:CCGGCCCTAGCAAACCATTGACAAACTCGAGTTTGTCAATGGTTTGCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-1069s1c1
Sequence:CCGGCCAGAGTCATCAGTTTCCATACTCGAGTATGGAAACTGATGACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-644s1c1
Sequence:CCGGCTCATCATTAAAGCACCGAATCTCGAGATTCGGTGCTTTAATGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1821s21c1
Sequence:CCGGGCTAACAATGACGGGCATAATCTCGAGATTATGCCCGTCATTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020586.1-1874s1c1
Sequence:CCGGCGGTTTAAATAACAGTGCAATCTCGAGATTGCACTGTTATTTAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020586
HERPUD2 MISSION shRNA Lentiviral Transduction Particles
HERPUD family member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1673s21c1
Sequence:CCGGCGTCCTCCTCAGCATCGTATACTCGAGTATACGATGCTGAGGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020586.2-2079s21c1
Sequence:CCGGCGGTTTAAATAACAGTGCAATCTCGAGATTGCACTGTTATTTAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1274s21c1
Sequence:CCGGCCAGAGTCATCAGTTTCCATACTCGAGTATGGAAACTGATGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-875s21c1
Sequence:CCGGATACAGTGACCAGACTATTAGCTCGAGCTAATAGTCTGGTCACTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-745s1c1
Sequence:CCGGCCCTAGCAAACCATTGACAAACTCGAGTTTGTCAATGGTTTGCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-1069s1c1
Sequence:CCGGCCAGAGTCATCAGTTTCCATACTCGAGTATGGAAACTGATGACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020586.1-644s1c1
Sequence:CCGGCTCATCATTAAAGCACCGAATCTCGAGATTCGGTGCTTTAATGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020586.2-1821s21c1
Sequence:CCGGGCTAACAATGACGGGCATAATCTCGAGATTATGCCCGTCATTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020586.1-1874s1c1
Sequence:CCGGCGGTTTAAATAACAGTGCAATCTCGAGATTGCACTGTTATTTAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)