EMAIL THIS PAGE TO A FRIEND

HES1

hairy and enhancer of split 1, (Drosophila)

67 Gene Product Result for
Synonyms: HES-1 HHL HRY bHLHb39
UniProtKB ID: Q14469, Q6FHB2
Gene ID:
Human(3280) Summary: This protein belongs to the basic helix-loop-helix family of transcription factors. It is a transcriptional repressor of genes that require a bHLH protein for their transcription. The protein has a particular type of basic domain that contains a helix interrupting protein that binds to the N-box rather than the canonical E-box. [provided by RefSeq, Jul 2008]
Mouse(15205) hairy and enhancer of split 1 (Drosophila)
Rat(29577) hairy and enhancer of split 1 (Drosophila)
chicken(395128) hairy and enhancer of split 1, (Drosophila)
cow(539547) hairy and enhancer of split 1, (Drosophila)
domestic cat(101091223) hairy and enhancer of split 1, (Drosophila)
domestic guinea pig(100734567) hairy and enhancer of split 1, (Drosophila)
naked mole-rat(101697897) hairy and enhancer of split 1, (Drosophila)
sheep(101106560) hairy and enhancer of split 1, (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108472 Anti-HES1 IgG fraction of antiserum rat, horse, human, pig, zebrafish, rabbit, mouse, guinea pig, bovine
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4301893 Anti-HES1 affinity isolated antibody human
immunohistochemistry pricing
AV32372 Anti-HES1 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, horse, human, mouse, rabbit, pig, rat, zebrafish
western blot pricing
SAB2106243 Anti-HES1 antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig, rat
western blot pricing
SAB1410659 Anti-HES1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
HPA050504 Anti-HES1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0003280M1 Monoclonal Anti-HES1 antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB3300102 Monoclonal Anti-HES1 antibody produced in mouse clone 4H1, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1403945 Monoclonal Anti-HES1 antibody produced in mouse clone 3A3, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing
SAB4100404 Monoclonal Anti-HES1 antibody produced in mouse clone HES1-A345, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_192801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_192801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_192801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005524 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013081 MISSION® esiRNA esiRNA targeting human HES1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005524 Rosetta Predictions human pricing
NM_024360 Rosetta Predictions rat pricing
NM_008235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138364 predicted 466
2 SASI_Hs01_00138366 predicted 515
3 SASI_Hs01_00138367 predicted 568
4 SASI_Hs01_00138368 predicted 478
5 SASI_Hs02_00339741 predicted 443
6 SASI_Hs01_00138370 predicted 1110
7 SASI_Hs02_00339742 predicted 568
8 SASI_Hs01_00138371 predicted 576
9 SASI_Hs01_00138372 predicted 1130
10 SASI_Hs01_00138373 predicted 511
11 SASI_Hs01_00138365 predicted 472
12 SASI_Hs01_00138369 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120127 predicted 474
2 SASI_Rn02_00263933 predicted 1071
3 SASI_Rn02_00263934 predicted 450
4 SASI_Rn02_00263935 predicted 342
5 SASI_Rn02_00263936 predicted 1084
6 SASI_Rn02_00263937 predicted 1101
7 SASI_Rn02_00263938 predicted 881
8 SASI_Rn02_00263939 predicted 1118
9 SASI_Rn01_00120131 predicted 536
10 SASI_Rn02_00263940 predicted 874
11 SASI_Rn01_00120125 predicted 1000
12 SASI_Rn01_00120126 predicted 993
13 SASI_Rn01_00120128 predicted 1097
14 SASI_Rn01_00120129 predicted 1019
15 SASI_Rn01_00120130 predicted 1192
16 SASI_Rn01_00120132 predicted 1039
17 SASI_Rn01_00120133 predicted 989
18 SASI_Rn01_00120134 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047341 predicted 442
2 SASI_Mm01_00047342 predicted 508
3 SASI_Mm01_00047344 predicted 1100
4 SASI_Mm01_00047345 predicted 483
5 SASI_Mm01_00047346 predicted 1000
6 SASI_Mm02_00313424 predicted 1085
7 SASI_Mm01_00047347 predicted 1014
8 SASI_Mm01_00047348 predicted 1048
9 SASI_Mm02_00313425 predicted 1058
10 SASI_Mm02_00313426 predicted 1091
11 SASI_Mm01_00047340 predicted 1108
12 SASI_Mm01_00047343 predicted 443
13 SASI_Mm01_00047349 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_192801
VALIDATED
HES1 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 1, (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-286s1c1
Sequence:CCGGCCAGCCAGTGTCAACACGACACTCGAGTGTCGTGTTGACACTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-365s1c1
Sequence:CCGGAGAGGCGAAGGGCAAGAATAACTCGAGTTATTCTTGCCCTTCGCCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-431s1c1
Sequence:CCGGAGAAAGATAGCTCCCGGCATTCTCGAGAATGCCGGGAGCTATCTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-678s1c1
Sequence:CCGGCCAGATCAACGCCATGACCTACTCGAGTAGGTCATGGCGTTGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_192801.2-387s1c1
Sequence:CCGGTGAAAGTCTAAGCCAACTGAACTCGAGTTCAGTTGGCTTAGACTTTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_192801
VALIDATED
HES1 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 1, (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-286s1c1
Sequence:CCGGCCAGCCAGTGTCAACACGACACTCGAGTGTCGTGTTGACACTGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-365s1c1
Sequence:CCGGAGAGGCGAAGGGCAAGAATAACTCGAGTTATTCTTGCCCTTCGCCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-431s1c1
Sequence:CCGGAGAAAGATAGCTCCCGGCATTCTCGAGAATGCCGGGAGCTATCTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-678s1c1
Sequence:CCGGCCAGATCAACGCCATGACCTACTCGAGTAGGTCATGGCGTTGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_192801.2-387s1c1
Sequence:CCGGTGAAAGTCTAAGCCAACTGAACTCGAGTTCAGTTGGCTTAGACTTTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_192801
VALIDATED
HES1 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 1, (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-286s1c1
Sequence:CCGGCCAGCCAGTGTCAACACGACACTCGAGTGTCGTGTTGACACTGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-365s1c1
Sequence:CCGGAGAGGCGAAGGGCAAGAATAACTCGAGTTATTCTTGCCCTTCGCCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-431s1c1
Sequence:CCGGAGAAAGATAGCTCCCGGCATTCTCGAGAATGCCGGGAGCTATCTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192801.2-678s1c1
Sequence:CCGGCCAGATCAACGCCATGACCTACTCGAGTAGGTCATGGCGTTGATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_192801.2-387s1c1
Sequence:CCGGTGAAAGTCTAAGCCAACTGAACTCGAGTTCAGTTGGCTTAGACTTTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005524
HES1 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 1, (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005524.2-1132s1c1
Sequence:CCGGCCGGACTCTAAACAGGAACTTCTCGAGAAGTTCCTGTTTAGAGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-914s1c1
Sequence:CCGGTGGCCAGTTTGCTTTCCTCATCTCGAGATGAGGAAAGCAAACTGGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-340s1c1
Sequence:CCGGGAAAGTCATCAAAGCCTATTACTCGAGTAATAGGCTTTGATGACTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-680s1c1
Sequence:CCGGCCAGATCAATGCCATGACCTACTCGAGTAGGTCATGGCATTGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-670s21c1
Sequence:CCGGACTGCATGACCCAGATCAATGCTCGAGCATTGATCTGGGTCATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-343s21c1
Sequence:GTACCGGAGTCATCAAAGCCTATTATGGCTCGAGCCATAATAGGCTTTGATGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005524.2-1250s21c1
Sequence:CCGGTGACTGACCATGCACTATATTCTCGAGAATATAGTGCATGGTCAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-297s21c1
Sequence:CCGGGTCAACACGACACCGGATAAACTCGAGTTTATCCGGTGTCGTGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-613s21c1
Sequence:CCGGCCACGTGCGAGGGCGTTAATACTCGAGTATTAACGCCCTCGCACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005524
HES1 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 1, (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005524.2-1132s1c1
Sequence:CCGGCCGGACTCTAAACAGGAACTTCTCGAGAAGTTCCTGTTTAGAGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-914s1c1
Sequence:CCGGTGGCCAGTTTGCTTTCCTCATCTCGAGATGAGGAAAGCAAACTGGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-340s1c1
Sequence:CCGGGAAAGTCATCAAAGCCTATTACTCGAGTAATAGGCTTTGATGACTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-680s1c1
Sequence:CCGGCCAGATCAATGCCATGACCTACTCGAGTAGGTCATGGCATTGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-670s21c1
Sequence:CCGGACTGCATGACCCAGATCAATGCTCGAGCATTGATCTGGGTCATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-343s21c1
Sequence:GTACCGGAGTCATCAAAGCCTATTATGGCTCGAGCCATAATAGGCTTTGATGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005524.2-1250s21c1
Sequence:CCGGTGACTGACCATGCACTATATTCTCGAGAATATAGTGCATGGTCAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-297s21c1
Sequence:CCGGGTCAACACGACACCGGATAAACTCGAGTTTATCCGGTGTCGTGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-613s21c1
Sequence:CCGGCCACGTGCGAGGGCGTTAATACTCGAGTATTAACGCCCTCGCACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005524
HES1 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 1, (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005524.2-1132s1c1
Sequence:CCGGCCGGACTCTAAACAGGAACTTCTCGAGAAGTTCCTGTTTAGAGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-914s1c1
Sequence:CCGGTGGCCAGTTTGCTTTCCTCATCTCGAGATGAGGAAAGCAAACTGGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-340s1c1
Sequence:CCGGGAAAGTCATCAAAGCCTATTACTCGAGTAATAGGCTTTGATGACTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005524.2-680s1c1
Sequence:CCGGCCAGATCAATGCCATGACCTACTCGAGTAGGTCATGGCATTGATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-670s21c1
Sequence:CCGGACTGCATGACCCAGATCAATGCTCGAGCATTGATCTGGGTCATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-343s21c1
Sequence:GTACCGGAGTCATCAAAGCCTATTATGGCTCGAGCCATAATAGGCTTTGATGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005524.2-1250s21c1
Sequence:CCGGTGACTGACCATGCACTATATTCTCGAGAATATAGTGCATGGTCAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-297s21c1
Sequence:CCGGGTCAACACGACACCGGATAAACTCGAGTTTATCCGGTGTCGTGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005524.2-613s21c1
Sequence:CCGGCCACGTGCGAGGGCGTTAATACTCGAGTATTAACGCCCTCGCACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008235
HES1 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 1, (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-296s21c1
Sequence:CCGGTCAACACGACACCGGACAAACCTCGAGGTTTGTCCGGTGTCGTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-432s21c1
Sequence:CCGGGAAAGATAGCTCCCGGCATTCCTCGAGGAATGCCGGGAGCTATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-366s21c1
Sequence:CCGGGAGGCGAAGGGCAAGAATAAACTCGAGTTTATTCTTGCCCTTCGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-674s21c1
Sequence:CCGGTGACCCAGATCAACGCCATGACTCGAGTCATGGCGTTGATCTGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008235.2-1127s21c1
Sequence:CCGGTCTCTTCTGACGGACACTAAACTCGAGTTTAGTGTCCGTCAGAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008235
HES1 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 1, (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-296s21c1
Sequence:CCGGTCAACACGACACCGGACAAACCTCGAGGTTTGTCCGGTGTCGTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-432s21c1
Sequence:CCGGGAAAGATAGCTCCCGGCATTCCTCGAGGAATGCCGGGAGCTATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-366s21c1
Sequence:CCGGGAGGCGAAGGGCAAGAATAAACTCGAGTTTATTCTTGCCCTTCGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-674s21c1
Sequence:CCGGTGACCCAGATCAACGCCATGACTCGAGTCATGGCGTTGATCTGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008235.2-1127s21c1
Sequence:CCGGTCTCTTCTGACGGACACTAAACTCGAGTTTAGTGTCCGTCAGAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008235
HES1 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 1, (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-296s21c1
Sequence:CCGGTCAACACGACACCGGACAAACCTCGAGGTTTGTCCGGTGTCGTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-432s21c1
Sequence:CCGGGAAAGATAGCTCCCGGCATTCCTCGAGGAATGCCGGGAGCTATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-366s21c1
Sequence:CCGGGAGGCGAAGGGCAAGAATAAACTCGAGTTTATTCTTGCCCTTCGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008235.2-674s21c1
Sequence:CCGGTGACCCAGATCAACGCCATGACTCGAGTCATGGCGTTGATCTGGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008235.2-1127s21c1
Sequence:CCGGTCTCTTCTGACGGACACTAAACTCGAGTTTAGTGTCCGTCAGAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)