EMAIL THIS PAGE TO A FRIEND

HES2

hairy and enhancer of split 2 (Drosophila)

68 Gene Product Result for
Synonyms: bHLHb40
UniProtKB ID: Q9Y543, A2RTZ9, Q96EN4, Q9Y542
Gene ID:
Mouse(15206) hairy and enhancer of split 2 (Drosophila)
Rat(29567) hairy and enhancer of split 2 (Drosophila)
sheep(101117179) hairy and enhancer of split 2 (Drosophila)
domestic guinea pig(100724940) hairy and enhancer of split 2 (Drosophila)
naked mole-rat(101705249) hairy and enhancer of split 2 (Drosophila)
cow(516433) hairy and enhancer of split 2 (Drosophila)
dog(607994) hairy and enhancer of split 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H4788 Anti-HES-2 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
SAB1412222 ANTI-HES2 antibody produced in mouse clone 4A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412223 ANTI-HES2 antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412226 ANTI-HES2 antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412370 ANTI-HES2 antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412371 ANTI-HES2 antibody produced in mouse clone 1B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412372 ANTI-HES2 antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412373 ANTI-HES2 antibody produced in mouse clone 3B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412374 ANTI-HES2 antibody produced in mouse clone 1D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA039462 Anti-HES2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0054626M1 Monoclonal Anti-HES2 antibody produced in mouse clone 4H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405133 Monoclonal Anti-HES2 antibody produced in mouse clone 3H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_375684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019089 Rosetta Predictions human pricing
NM_019236 Rosetta Predictions rat pricing
NM_008236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094884 predicted 747
2 SASI_Hs01_00094885 predicted 2243
3 SASI_Hs01_00094886 predicted 2759
4 SASI_Hs02_00352688 predicted 2475
5 SASI_Hs01_00094887 predicted 3843
6 SASI_Hs01_00094888 predicted 2876
7 SASI_Hs01_00094889 predicted 3918
8 SASI_Hs01_00094890 predicted 2031
9 SASI_Hs02_00352689 predicted 2547
10 SASI_Hs02_00352690 predicted 3313
11 SASI_Hs01_00094881 predicted 890
12 SASI_Hs01_00094882 predicted 265
13 SASI_Hs01_00094883 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056613 predicted 250
2 SASI_Rn01_00056614 predicted 215
3 SASI_Rn01_00056615 predicted 321
4 SASI_Rn01_00056618 predicted 263
5 SASI_Rn01_00056620 predicted 329
6 SASI_Rn01_00056621 predicted 342
7 SASI_Rn01_00056622 predicted 304
8 SASI_Rn02_00262103 predicted 219
9 SASI_Rn02_00262104 predicted 283
10 SASI_Rn02_00262105 predicted 247
11 SASI_Rn01_00056616 predicted 359
12 SASI_Rn01_00056617 predicted 208
13 SASI_Rn01_00056619 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108624 predicted 815
2 SASI_Mm01_00108625 predicted 810
3 SASI_Mm01_00108626 predicted 1094
4 SASI_Mm01_00108627 predicted 690
5 SASI_Mm01_00108628 predicted 688
6 SASI_Mm01_00108629 predicted 460
7 SASI_Mm02_00313427 predicted 479
8 SASI_Mm01_00108630 predicted 229
9 SASI_Mm01_00108631 predicted 757
10 SASI_Mm01_00108632 predicted 595
11 SASI_Mm01_00108633 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008236
HES2 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 2 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008236.4-727s21c1
Sequence:CCGGGCCCTGTCAAGAATCAGATACCTCGAGGTATCTGATTCTTGACAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008236.4-1006s21c1
Sequence:CCGGTGGGCTTGTGACGTCTTTATGCTCGAGCATAAAGACGTCACAAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008236.4-274s21c1
Sequence:CCGGCCGCTCTTCGAAGTTGGAGAACTCGAGTTCTCCAACTTCGAAGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008236.4-231s21c1
Sequence:CCAGAGCTGAAGGGTCTCGTATTGCCTCGAGGCAATACGAGACCCTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008236.2-2361s1c1
Sequence:CCGGCCACACATAAGAACTCTCAATCTCGAGATTGAGAGTTCTTATGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-207s1c1
Sequence:CCGGGCGCGGATCAACGAGAGCCTACTCGAGTAGGCTCTCGTTGATCCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-559s1c1
Sequence:CCGGCGGTGCCTCCTCCAGGCAGTTCTCGAGAACTGCCTGGAGGAGGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-371s1c1
Sequence:CCGGGCCTTTGAATAGCTACCTCGACTCGAGTCGAGGTAGCTATTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-305s1c1
Sequence:CCGGCCTGGAAATGACTGTGCGCTTCTCGAGAAGCGCACAGTCATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008236
HES2 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 2 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008236.4-727s21c1
Sequence:CCGGGCCCTGTCAAGAATCAGATACCTCGAGGTATCTGATTCTTGACAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008236.4-1006s21c1
Sequence:CCGGTGGGCTTGTGACGTCTTTATGCTCGAGCATAAAGACGTCACAAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008236.4-274s21c1
Sequence:CCGGCCGCTCTTCGAAGTTGGAGAACTCGAGTTCTCCAACTTCGAAGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008236.4-231s21c1
Sequence:CCAGAGCTGAAGGGTCTCGTATTGCCTCGAGGCAATACGAGACCCTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008236.2-2361s1c1
Sequence:CCGGCCACACATAAGAACTCTCAATCTCGAGATTGAGAGTTCTTATGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-207s1c1
Sequence:CCGGGCGCGGATCAACGAGAGCCTACTCGAGTAGGCTCTCGTTGATCCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-559s1c1
Sequence:CCGGCGGTGCCTCCTCCAGGCAGTTCTCGAGAACTGCCTGGAGGAGGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-371s1c1
Sequence:CCGGGCCTTTGAATAGCTACCTCGACTCGAGTCGAGGTAGCTATTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-305s1c1
Sequence:CCGGCCTGGAAATGACTGTGCGCTTCTCGAGAAGCGCACAGTCATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008236
HES2 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 2 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008236.4-727s21c1
Sequence:CCGGGCCCTGTCAAGAATCAGATACCTCGAGGTATCTGATTCTTGACAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008236.4-1006s21c1
Sequence:CCGGTGGGCTTGTGACGTCTTTATGCTCGAGCATAAAGACGTCACAAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008236.4-274s21c1
Sequence:CCGGCCGCTCTTCGAAGTTGGAGAACTCGAGTTCTCCAACTTCGAAGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008236.4-231s21c1
Sequence:CCAGAGCTGAAGGGTCTCGTATTGCCTCGAGGCAATACGAGACCCTTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008236.2-2361s1c1
Sequence:CCGGCCACACATAAGAACTCTCAATCTCGAGATTGAGAGTTCTTATGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-207s1c1
Sequence:CCGGGCGCGGATCAACGAGAGCCTACTCGAGTAGGCTCTCGTTGATCCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-559s1c1
Sequence:CCGGCGGTGCCTCCTCCAGGCAGTTCTCGAGAACTGCCTGGAGGAGGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-371s1c1
Sequence:CCGGGCCTTTGAATAGCTACCTCGACTCGAGTCGAGGTAGCTATTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008236.2-305s1c1
Sequence:CCGGCCTGGAAATGACTGTGCGCTTCTCGAGAAGCGCACAGTCATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375684
HES2 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 2 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-393s1c1
Sequence:CCGGCCTGGAAATGACCGTGCGCTTCTCGAGAAGCGCACGGTCATTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-363s1c1
Sequence:CCGGCAACTGCTCGAAGCTAGAGAACTCGAGTTCTCTAGCTTCGAGCAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-459s1c1
Sequence:CCGGGCCTTGCGACAGCTACCGCGACTCGAGTCGCGGTAGCTGTCGCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-562s1c1
Sequence:CCGGCTGGAGCACCTGTGGCGGAGACTCGAGTCTCCGCCACAGGTGCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-296s1c1
Sequence:CCGGCGCGCATCAACCAGAGCCTGACTCGAGTCAGGCTCTGGTTGATGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375684
HES2 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 2 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-393s1c1
Sequence:CCGGCCTGGAAATGACCGTGCGCTTCTCGAGAAGCGCACGGTCATTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-363s1c1
Sequence:CCGGCAACTGCTCGAAGCTAGAGAACTCGAGTTCTCTAGCTTCGAGCAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-459s1c1
Sequence:CCGGGCCTTGCGACAGCTACCGCGACTCGAGTCGCGGTAGCTGTCGCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-562s1c1
Sequence:CCGGCTGGAGCACCTGTGGCGGAGACTCGAGTCTCCGCCACAGGTGCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-296s1c1
Sequence:CCGGCGCGCATCAACCAGAGCCTGACTCGAGTCAGGCTCTGGTTGATGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375684
HES2 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 2 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-393s1c1
Sequence:CCGGCCTGGAAATGACCGTGCGCTTCTCGAGAAGCGCACGGTCATTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-363s1c1
Sequence:CCGGCAACTGCTCGAAGCTAGAGAACTCGAGTTCTCTAGCTTCGAGCAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-459s1c1
Sequence:CCGGGCCTTGCGACAGCTACCGCGACTCGAGTCGCGGTAGCTGTCGCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-562s1c1
Sequence:CCGGCTGGAGCACCTGTGGCGGAGACTCGAGTCTCCGCCACAGGTGCTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375684.1-296s1c1
Sequence:CCGGCGCGCATCAACCAGAGCCTGACTCGAGTCAGGCTCTGGTTGATGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)