EMAIL THIS PAGE TO A FRIEND

HES3

hairy and enhancer of split 3 (Drosophila)

49 Gene Product Result for
Synonyms: bHLHb43
UniProtKB ID: Q5TGS1, Q5TGS0
Gene ID:
Mouse(15207) hairy and enhancer of split 3 (Drosophila)
Rat(64628) hairy and enhancer of split 3 (Drosophila)
dog(489629) hairy and enhancer of split 3 (Drosophila)
cow(615356) hairy and enhancer of split 3 (Drosophila)
domestic guinea pig(100734445) hairy and enhancer of split 3 (Drosophila)
naked mole-rat(101710408) hairy and enhancer of split 3 (Drosophila)
sheep(101117436) hairy and enhancer of split 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_372757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372757 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024598 Rosetta Predictions human pricing
NM_022687 Rosetta Predictions rat pricing
NM_008237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079111 predicted 77
2 SASI_Hs01_00079112 predicted 124
3 SASI_Hs01_00079113 predicted 68
4 SASI_Hs02_00307177 predicted 620
5 SASI_Hs01_00079117 predicted 190
6 SASI_Hs02_00307178 predicted 616
7 SASI_Hs02_00307179 predicted 602
8 SASI_Hs02_00307180 predicted 528
9 SASI_Hs02_00307181 predicted 489
10 SASI_Hs02_00307182 predicted 285
11 SASI_Hs01_00079110 predicted 1047
12 SASI_Hs01_00079114 predicted 308
13 SASI_Hs01_00079115 predicted 985
14 SASI_Hs01_00079116 predicted 308
15 SASI_Hs01_00079118 predicted 996
16 SASI_Hs01_00079119 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068584 predicted 403
2 SASI_Rn01_00068585 predicted 351
3 SASI_Rn01_00068586 predicted 422
4 SASI_Rn01_00068587 predicted 319
5 SASI_Rn02_00263475 predicted 317
6 SASI_Rn01_00068588 predicted 413
7 SASI_Rn01_00068589 predicted 439
8 SASI_Rn01_00068590 predicted 395
9 SASI_Rn01_00068591 predicted 360
10 SASI_Rn01_00068592 predicted 593
11 SASI_Rn01_00068583 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123612 predicted 398
2 SASI_Mm01_00123613 predicted 814
3 SASI_Mm01_00123614 predicted 501
4 SASI_Mm01_00123615 predicted 503
5 SASI_Mm01_00123616 predicted 699
6 SASI_Mm01_00123617 predicted 451
7 SASI_Mm01_00123618 predicted 1073
8 SASI_Mm01_00123619 predicted 830
9 SASI_Mm01_00123620 predicted 918
10 SASI_Mm01_00123621 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008237
HES3 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 3 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-74s1c1
Sequence:CCGGCACATCAGATACGGAAACGAACTCGAGTTCGTTTCCGTATCTGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-63s1c1
Sequence:CCGGGAGACACTACTCACATCAGATCTCGAGATCTGATGTGAGTAGTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-220s1c1
Sequence:CCGGCGTGGCGTGAGCCAGAGGCTTCTCGAGAAGCCTCTGGCTCACGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-328s1c1
Sequence:CCGGGCGACCTCTGTTCTCAACCCTCTCGAGAGGGTTGAGAACAGAGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-84s1c1
Sequence:CCGGACGGAAACGAAAGCTGGAGAACTCGAGTTCTCCAGCTTTCGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008237.4-1057s21c1
Sequence:CCGGTCCACGGAACCATTGGCGATTCTCGAGAATCGCCAATGGTTCCGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008237.4-1007s21c1
Sequence:CCGGACTGCAGGAACTCTATCAATCCTCGAGGATTGATAGAGTTCCTGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008237.4-913s21c1
Sequence:CCGGAGACGTAGGCAAGGATTTAGACTCGAGTCTAAATCCTTGCCTACGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008237.4-842s21c1
Sequence:CCGGGCACCACATCCTGCATCAAACCTCGAGGTTTGATGCAGGATGTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008237
HES3 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 3 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-74s1c1
Sequence:CCGGCACATCAGATACGGAAACGAACTCGAGTTCGTTTCCGTATCTGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-63s1c1
Sequence:CCGGGAGACACTACTCACATCAGATCTCGAGATCTGATGTGAGTAGTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-220s1c1
Sequence:CCGGCGTGGCGTGAGCCAGAGGCTTCTCGAGAAGCCTCTGGCTCACGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-328s1c1
Sequence:CCGGGCGACCTCTGTTCTCAACCCTCTCGAGAGGGTTGAGAACAGAGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-84s1c1
Sequence:CCGGACGGAAACGAAAGCTGGAGAACTCGAGTTCTCCAGCTTTCGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008237.4-1057s21c1
Sequence:CCGGTCCACGGAACCATTGGCGATTCTCGAGAATCGCCAATGGTTCCGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008237.4-1007s21c1
Sequence:CCGGACTGCAGGAACTCTATCAATCCTCGAGGATTGATAGAGTTCCTGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008237.4-913s21c1
Sequence:CCGGAGACGTAGGCAAGGATTTAGACTCGAGTCTAAATCCTTGCCTACGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008237.4-842s21c1
Sequence:CCGGGCACCACATCCTGCATCAAACCTCGAGGTTTGATGCAGGATGTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008237
HES3 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 3 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-74s1c1
Sequence:CCGGCACATCAGATACGGAAACGAACTCGAGTTCGTTTCCGTATCTGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-63s1c1
Sequence:CCGGGAGACACTACTCACATCAGATCTCGAGATCTGATGTGAGTAGTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-220s1c1
Sequence:CCGGCGTGGCGTGAGCCAGAGGCTTCTCGAGAAGCCTCTGGCTCACGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-328s1c1
Sequence:CCGGGCGACCTCTGTTCTCAACCCTCTCGAGAGGGTTGAGAACAGAGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008237.1-84s1c1
Sequence:CCGGACGGAAACGAAAGCTGGAGAACTCGAGTTCTCCAGCTTTCGTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008237.4-1057s21c1
Sequence:CCGGTCCACGGAACCATTGGCGATTCTCGAGAATCGCCAATGGTTCCGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008237.4-1007s21c1
Sequence:CCGGACTGCAGGAACTCTATCAATCCTCGAGGATTGATAGAGTTCCTGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008237.4-913s21c1
Sequence:CCGGAGACGTAGGCAAGGATTTAGACTCGAGTCTAAATCCTTGCCTACGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008237.4-842s21c1
Sequence:CCGGGCACCACATCCTGCATCAAACCTCGAGGTTTGATGCAGGATGTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372757
HES3 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 3 (Drosophila)
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000020639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372757.1-35s1c1
Sequence:CCGGCCGGCAACTTCCGAAAGATTTCTCGAGAAATCTTTCGGAAGTTGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372757.1-204s1c1
Sequence:CCGGGAGAAGCCTTCAGAACTCCTTCTCGAGAAGGAGTTCTGAAGGCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372757
HES3 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 3 (Drosophila)
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000020639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372757.1-35s1c1
Sequence:CCGGCCGGCAACTTCCGAAAGATTTCTCGAGAAATCTTTCGGAAGTTGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372757.1-204s1c1
Sequence:CCGGGAGAAGCCTTCAGAACTCCTTCTCGAGAAGGAGTTCTGAAGGCTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372757
HES3 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 3 (Drosophila)
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000020639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372757.1-35s1c1
Sequence:CCGGCCGGCAACTTCCGAAAGATTTCTCGAGAAATCTTTCGGAAGTTGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372757.1-204s1c1
Sequence:CCGGGAGAAGCCTTCAGAACTCCTTCTCGAGAAGGAGTTCTGAAGGCTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)