EMAIL THIS PAGE TO A FRIEND

HES4

hairy and enhancer of split 4 (Drosophila)

18 Gene Product Result for
Synonyms: bHLHb42
UniProtKB ID: Q9HCC6, Q5SVA5
Gene ID:
dog(489604) hairy and enhancer of split 4 (Drosophila)
cow(507480) hairy and enhancer of split 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021170 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021170 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012351 predicted 248
2 SASI_Hs01_00012352 predicted 315
3 SASI_Hs01_00012353 predicted 243
4 SASI_Hs01_00012354 predicted 440
5 SASI_Hs02_00354725 predicted 226
6 SASI_Hs01_00012355 predicted 246
7 SASI_Hs01_00012356 predicted 247
8 SASI_Hs01_00012357 predicted 241
9 SASI_Hs01_00012359 predicted 245
10 SASI_Hs02_00354726 predicted 207
11 SASI_Hs01_00012358 predicted 383
12 SASI_Hs01_00012360 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021170
HES4 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 4 (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021170.3-435s21c1
Sequence:CCGGACATCCTGGAGATGACCGTGACTCGAGTCACGGTCATCTCCAGGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021170.3-420s21c1
Sequence:CCGGAGCTGGAGAAGGCGGACATCCCTCGAGGGATGTCCGCCTTCTCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-222s1c1
Sequence:CCGGCAAGTCCTCCAAGCCGGTCATCTCGAGATGACCGGCTTGGAGGACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-262s1c1
Sequence:CCGGCGTATTAACGAGAGCCTCGCTCTCGAGAGCGAGGCTCTCGTTAATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-459s1c1
Sequence:CCGGCCACGAGTGTCTGGCGGAGGTCTCGAGACCTCCGCCAGACACTCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-365s1c1
Sequence:CCGGTGACCGTGAGACACCTGCGGACTCGAGTCCGCAGGTGTCTCACGGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021170
HES4 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 4 (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021170.3-435s21c1
Sequence:CCGGACATCCTGGAGATGACCGTGACTCGAGTCACGGTCATCTCCAGGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021170.3-420s21c1
Sequence:CCGGAGCTGGAGAAGGCGGACATCCCTCGAGGGATGTCCGCCTTCTCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-222s1c1
Sequence:CCGGCAAGTCCTCCAAGCCGGTCATCTCGAGATGACCGGCTTGGAGGACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-262s1c1
Sequence:CCGGCGTATTAACGAGAGCCTCGCTCTCGAGAGCGAGGCTCTCGTTAATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-459s1c1
Sequence:CCGGCCACGAGTGTCTGGCGGAGGTCTCGAGACCTCCGCCAGACACTCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-365s1c1
Sequence:CCGGTGACCGTGAGACACCTGCGGACTCGAGTCCGCAGGTGTCTCACGGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021170
HES4 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 4 (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021170.3-435s21c1
Sequence:CCGGACATCCTGGAGATGACCGTGACTCGAGTCACGGTCATCTCCAGGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021170.3-420s21c1
Sequence:CCGGAGCTGGAGAAGGCGGACATCCCTCGAGGGATGTCCGCCTTCTCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-222s1c1
Sequence:CCGGCAAGTCCTCCAAGCCGGTCATCTCGAGATGACCGGCTTGGAGGACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-262s1c1
Sequence:CCGGCGTATTAACGAGAGCCTCGCTCTCGAGAGCGAGGCTCTCGTTAATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-459s1c1
Sequence:CCGGCCACGAGTGTCTGGCGGAGGTCTCGAGACCTCCGCCAGACACTCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021170.2-365s1c1
Sequence:CCGGTGACCGTGAGACACCTGCGGACTCGAGTCCGCAGGTGTCTCACGGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)