EMAIL THIS PAGE TO A FRIEND

HES6

hairy and enhancer of split 6 (Drosophila)

87 Gene Product Result for
Synonyms: C-HAIRY1 HES-6 bHLHb41 bHLHc23
UniProtKB ID: Q96HZ4, A8KAP6, Q53SN9, Q8N2J2, Q96T93, Q9P2S3
Gene ID:
Human(55502) Summary: This gene encodes a member of a subfamily of basic helix-loop-helix transcription repressors that have homology to the Drosophila enhancer of split genes. Members of this gene family regulate cell differentiation in numerous cell types. The protein encoded by this gene functions as a cofactor, interacting with other transcription factors through a tetrapeptide domain in its C-terminus. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Dec 2008]
Mouse(55927) hairy and enhancer of split 6
Rat(316626) hairy and enhancer of split 6 (Drosophila)
domestic guinea pig(100728444) hairy and enhancer of split 6 (Drosophila)
naked mole-rat(101722997) hairy and enhancer of split 6 (Drosophila)
Zebrafish(373116) hairy and enhancer of split 6 (Drosophila)
cow(531384) hairy and enhancer of split 6 (Drosophila)
domestic cat(101093130) hairy and enhancer of split 6 (Drosophila)
dog(607298) hairy and enhancer of split 6 (Drosophila)
chicken(424829) hairy and enhancer of split 6 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018645 Rosetta Predictions human pricing
NM_001013179 Rosetta Predictions rat pricing
NM_019479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176290 predicted 1130
2 SASI_Hs02_00352145 predicted 1024
3 SASI_Hs01_00176291 predicted 786
4 SASI_Hs01_00176292 predicted 764
5 SASI_Hs01_00176293 predicted 887
6 SASI_Hs01_00176294 predicted 942
7 SASI_Hs01_00176295 predicted 779
8 SASI_Hs01_00176296 predicted 908
9 SASI_Hs01_00176297 predicted 408
10 SASI_Hs01_00176298 predicted 769
11 SASI_Hs01_00176299 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097372 predicted 820
2 SASI_Rn01_00097373 predicted 760
3 SASI_Rn01_00097374 predicted 279
4 SASI_Rn01_00097375 predicted 831
5 SASI_Rn01_00097376 predicted 508
6 SASI_Rn01_00097377 predicted 437
7 SASI_Rn02_00200936 predicted 714
8 SASI_Rn01_00097378 predicted 471
9 SASI_Rn01_00097379 predicted 444
10 SASI_Rn01_00097380 predicted 752
11 SASI_Rn01_00097371 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029270 predicted 745
2 SASI_Mm01_00029271 predicted 874
3 SASI_Mm01_00029272 predicted 1070
4 SASI_Mm01_00029273 predicted 194
5 SASI_Mm01_00029274 predicted 1084
6 SASI_Mm01_00029275 predicted 687
7 SASI_Mm01_00029276 predicted 640
8 SASI_Mm01_00029277 predicted 1073
9 SASI_Mm01_00029278 predicted 772
10 SASI_Mm01_00029279 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019479
VALIDATED
HES6 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 6 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019479.2-656s1c1
Sequence:CCGGGCTGAACTAAACCGGGTGCCTCTCGAGAGGCACCCGGTTTAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-469s1c1
Sequence:CCGGCCTGCTAGAATCCATGCCGCTCTCGAGAGCGGCATGGATTCTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019479.2-1149s1c1
Sequence:CCGGCCTGAAAGGAAGTTCAGATTTCTCGAGAAATCTGAACTTCCTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-200s1c1
Sequence:CCGGGCACGGATCAACGAGAGTCTTCTCGAGAAGACTCTCGTTGATCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-693s1c1
Sequence:CCGGTGGTGTCTACATCCTTAGGCACTCGAGTGCCTAAGGATGTAGACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-751s21c1
Sequence:CCGGGCCTTGGTGACCAACACTTACCTCGAGGTAAGTGTTGGTCACCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-383s21c1
Sequence:CCGGTACATCCAGTGCATGCATGAGCTCGAGCTCATGCATGCACTGGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-623s21c1
Sequence:CCGGGACCTGTGTTCTGACCTAGAGCTCGAGCTCTAGGTCAGAACACAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-693s21c1
Sequence:CCGGTGGTGTCTACATCCTTAGGCACTCGAGTGCCTAAGGATGTAGACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-919s21c1
Sequence:CCGGTGCAGGTCCCTAGCACTATTTCTCGAGAAATAGTGCTAGGGACCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019479
VALIDATED
HES6 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 6 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019479.2-656s1c1
Sequence:CCGGGCTGAACTAAACCGGGTGCCTCTCGAGAGGCACCCGGTTTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-469s1c1
Sequence:CCGGCCTGCTAGAATCCATGCCGCTCTCGAGAGCGGCATGGATTCTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019479.2-1149s1c1
Sequence:CCGGCCTGAAAGGAAGTTCAGATTTCTCGAGAAATCTGAACTTCCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-200s1c1
Sequence:CCGGGCACGGATCAACGAGAGTCTTCTCGAGAAGACTCTCGTTGATCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-693s1c1
Sequence:CCGGTGGTGTCTACATCCTTAGGCACTCGAGTGCCTAAGGATGTAGACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-751s21c1
Sequence:CCGGGCCTTGGTGACCAACACTTACCTCGAGGTAAGTGTTGGTCACCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-383s21c1
Sequence:CCGGTACATCCAGTGCATGCATGAGCTCGAGCTCATGCATGCACTGGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-623s21c1
Sequence:CCGGGACCTGTGTTCTGACCTAGAGCTCGAGCTCTAGGTCAGAACACAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-693s21c1
Sequence:CCGGTGGTGTCTACATCCTTAGGCACTCGAGTGCCTAAGGATGTAGACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-919s21c1
Sequence:CCGGTGCAGGTCCCTAGCACTATTTCTCGAGAAATAGTGCTAGGGACCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019479
VALIDATED
HES6 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 6 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019479.2-656s1c1
Sequence:CCGGGCTGAACTAAACCGGGTGCCTCTCGAGAGGCACCCGGTTTAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-469s1c1
Sequence:CCGGCCTGCTAGAATCCATGCCGCTCTCGAGAGCGGCATGGATTCTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019479.2-1149s1c1
Sequence:CCGGCCTGAAAGGAAGTTCAGATTTCTCGAGAAATCTGAACTTCCTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-200s1c1
Sequence:CCGGGCACGGATCAACGAGAGTCTTCTCGAGAAGACTCTCGTTGATCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019479.2-693s1c1
Sequence:CCGGTGGTGTCTACATCCTTAGGCACTCGAGTGCCTAAGGATGTAGACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-751s21c1
Sequence:CCGGGCCTTGGTGACCAACACTTACCTCGAGGTAAGTGTTGGTCACCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-383s21c1
Sequence:CCGGTACATCCAGTGCATGCATGAGCTCGAGCTCATGCATGCACTGGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-623s21c1
Sequence:CCGGGACCTGTGTTCTGACCTAGAGCTCGAGCTCTAGGTCAGAACACAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-693s21c1
Sequence:CCGGTGGTGTCTACATCCTTAGGCACTCGAGTGCCTAAGGATGTAGACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019479.3-919s21c1
Sequence:CCGGTGCAGGTCCCTAGCACTATTTCTCGAGAAATAGTGCTAGGGACCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018645
HES6 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 6 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-751s1c1
Sequence:CCGGCAGCCTGACCACAGCCCAAATCTCGAGATTTGGGCTGTGGTCAGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-418s1c1
Sequence:CCGGCGGCTACATCCAGTGCATGCACTCGAGTGCATGCACTGGATGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-241s1c1
Sequence:CCGGGCGGATCAACGAGAGCCTGCACTCGAGTGCAGGCTCTCGTTGATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-695s1c1
Sequence:CCGGGCTGAACTGAGTCAGGCTCCTCTCGAGAGGAGCCTGACTCAGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-493s1c1
Sequence:CCGGCGAGCTCCTGAACCATCTGCTCTCGAGAGCAGATGGTTCAGGAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018645.4-1196s21c1
Sequence:CCGGAGCTTGAACTTGCCACTTCAGCTCGAGCTGAAGTGGCAAGTTCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018645.4-449s21c1
Sequence:CCGGACGAGGTGCACACGTTCGTGTCTCGAGACACGAACGTGTGCACCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018645.4-929s21c1
Sequence:CCGGTCCTCTGATGGATGGCTTGCACTCGAGTGCAAGCCATCCATCAGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018645
HES6 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 6 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-751s1c1
Sequence:CCGGCAGCCTGACCACAGCCCAAATCTCGAGATTTGGGCTGTGGTCAGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-418s1c1
Sequence:CCGGCGGCTACATCCAGTGCATGCACTCGAGTGCATGCACTGGATGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-241s1c1
Sequence:CCGGGCGGATCAACGAGAGCCTGCACTCGAGTGCAGGCTCTCGTTGATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-695s1c1
Sequence:CCGGGCTGAACTGAGTCAGGCTCCTCTCGAGAGGAGCCTGACTCAGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-493s1c1
Sequence:CCGGCGAGCTCCTGAACCATCTGCTCTCGAGAGCAGATGGTTCAGGAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018645.4-1196s21c1
Sequence:CCGGAGCTTGAACTTGCCACTTCAGCTCGAGCTGAAGTGGCAAGTTCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018645.4-449s21c1
Sequence:CCGGACGAGGTGCACACGTTCGTGTCTCGAGACACGAACGTGTGCACCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018645.4-929s21c1
Sequence:CCGGTCCTCTGATGGATGGCTTGCACTCGAGTGCAAGCCATCCATCAGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018645
HES6 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 6 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-751s1c1
Sequence:CCGGCAGCCTGACCACAGCCCAAATCTCGAGATTTGGGCTGTGGTCAGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-418s1c1
Sequence:CCGGCGGCTACATCCAGTGCATGCACTCGAGTGCATGCACTGGATGTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-241s1c1
Sequence:CCGGGCGGATCAACGAGAGCCTGCACTCGAGTGCAGGCTCTCGTTGATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-695s1c1
Sequence:CCGGGCTGAACTGAGTCAGGCTCCTCTCGAGAGGAGCCTGACTCAGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018645.3-493s1c1
Sequence:CCGGCGAGCTCCTGAACCATCTGCTCTCGAGAGCAGATGGTTCAGGAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018645.4-1196s21c1
Sequence:CCGGAGCTTGAACTTGCCACTTCAGCTCGAGCTGAAGTGGCAAGTTCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018645.4-449s21c1
Sequence:CCGGACGAGGTGCACACGTTCGTGTCTCGAGACACGAACGTGTGCACCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018645.4-929s21c1
Sequence:CCGGTCCTCTGATGGATGGCTTGCACTCGAGTGCAAGCCATCCATCAGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)