EMAIL THIS PAGE TO A FRIEND

HES7

hairy and enhancer of split 7 (Drosophila)

84 Gene Product Result for
Synonyms: SCDO4 bHLHb37
UniProtKB ID: Q9BYE0, F8VPC9
Gene ID:
Human(84667) Summary: This gene encodes a member of the hairy and enhancer of split family of bHLH transcription factors. The mouse ortholog of this gene is regulated by Notch signaling. The protein functions as a transcriptional repressor, and is implicated in correct patterning of the axial skeleton. A mutation in this gene has been shown to result in spondylocostal dysostosis. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(84653) hairy and enhancer of split 7 (Drosophila)
Rat(287423) hairy and enhancer of split 7 (Drosophila)
chicken(419391) hairy and enhancer of split 7 (Drosophila)
domestic cat(101080335) hairy and enhancer of split 7 (Drosophila)
cow(617638) hairy and enhancer of split 7 (Drosophila)
dog(612802) hairy and enhancer of split 7 (Drosophila)
sheep(101121950) hairy and enhancer of split 7 (Drosophila)
domestic guinea pig(100731446) hairy and enhancer of split 7 (Drosophila)
naked mole-rat(101709909) hairy and enhancer of split 7 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032580 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032580 Rosetta Predictions human pricing
NM_001105792 Rosetta Predictions rat pricing
NM_033041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360106 predicted 1007
2 SASI_Hs01_00170086 predicted 253
3 SASI_Hs02_00360107 predicted 942
4 SASI_Hs01_00170085 predicted 285
5 SASI_Hs02_00360108 predicted 944
6 SASI_Hs02_00360109 predicted 1004
7 SASI_Hs01_00170087 predicted 254
8 SASI_Hs02_00360110 predicted 952
9 SASI_Hs01_00170088 predicted 393
10 SASI_Hs02_00360111 predicted 944
11 SASI_Hs01_00170089 predicted 257
12 SASI_Hs01_00170090 predicted 337
13 SASI_Hs01_00170091 predicted 401
14 SASI_Hs01_00170092 predicted 279
15 SASI_Hs01_00170093 predicted 273
16 SASI_Hs01_00170094 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212576 predicted 364
2 SASI_Rn02_00212577 predicted 293
3 SASI_Rn02_00212578 predicted 262
4 SASI_Rn02_00212579 predicted 333
5 SASI_Rn02_00212580 predicted 249
6 SASI_Rn02_00212581 predicted 259
7 SASI_Rn02_00212582 predicted 257
8 SASI_Rn02_00212583 predicted 332
9 SASI_Rn02_00212584 predicted 391
10 SASI_Rn02_00212585 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177288 predicted 304
2 SASI_Mm01_00177289 predicted 282
3 SASI_Mm01_00177290 predicted 354
4 SASI_Mm01_00177291 predicted 409
5 SASI_Mm01_00177292 predicted 270
6 SASI_Mm01_00177293 predicted 660
7 SASI_Mm01_00177294 predicted 309
8 SASI_Mm01_00177295 predicted 413
9 SASI_Mm01_00177296 predicted 271
10 SASI_Mm01_00177297 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033041
HES7 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 7 (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033041.4-60s21c1
Sequence:CCGGCAAGATGCTGAAGCCGTTGGTCTCGAGACCAACGGCTTCAGCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-184s1c1
Sequence:CCGGGAAAGCGGAGATACTGGAGTTCTCGAGAACTCCAGTATCTCCGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-167s1c1
Sequence:CCGGCGGAACCCGAAGCTGGAGAAACTCGAGTTTCTCCAGCTTCGGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033041.4-200s21c1
Sequence:CCGGAGTTCGCCGTGGGCTACTTGACTCGAGTCAAGTAGCCCACGGCGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-178s1c1
Sequence:CCGGGCTGGAGAAAGCGGAGATACTCTCGAGAGTATCTCCGCTTTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033041.2-807s1c1
Sequence:CCGGCGGGTGAGATGTGGTCTATATCTCGAGATATAGACCACATCTCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-622s1c1
Sequence:CCGGGCCACCGCCTTACAGACAAGACTCGAGTCTTGTCTGTAAGGCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033041
HES7 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 7 (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033041.4-60s21c1
Sequence:CCGGCAAGATGCTGAAGCCGTTGGTCTCGAGACCAACGGCTTCAGCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-184s1c1
Sequence:CCGGGAAAGCGGAGATACTGGAGTTCTCGAGAACTCCAGTATCTCCGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-167s1c1
Sequence:CCGGCGGAACCCGAAGCTGGAGAAACTCGAGTTTCTCCAGCTTCGGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033041.4-200s21c1
Sequence:CCGGAGTTCGCCGTGGGCTACTTGACTCGAGTCAAGTAGCCCACGGCGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-178s1c1
Sequence:CCGGGCTGGAGAAAGCGGAGATACTCTCGAGAGTATCTCCGCTTTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033041.2-807s1c1
Sequence:CCGGCGGGTGAGATGTGGTCTATATCTCGAGATATAGACCACATCTCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-622s1c1
Sequence:CCGGGCCACCGCCTTACAGACAAGACTCGAGTCTTGTCTGTAAGGCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033041
HES7 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 7 (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033041.4-60s21c1
Sequence:CCGGCAAGATGCTGAAGCCGTTGGTCTCGAGACCAACGGCTTCAGCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-184s1c1
Sequence:CCGGGAAAGCGGAGATACTGGAGTTCTCGAGAACTCCAGTATCTCCGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-167s1c1
Sequence:CCGGCGGAACCCGAAGCTGGAGAAACTCGAGTTTCTCCAGCTTCGGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033041.4-200s21c1
Sequence:CCGGAGTTCGCCGTGGGCTACTTGACTCGAGTCAAGTAGCCCACGGCGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-178s1c1
Sequence:CCGGGCTGGAGAAAGCGGAGATACTCTCGAGAGTATCTCCGCTTTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033041.2-807s1c1
Sequence:CCGGCGGGTGAGATGTGGTCTATATCTCGAGATATAGACCACATCTCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033041.2-622s1c1
Sequence:CCGGGCCACCGCCTTACAGACAAGACTCGAGTCTTGTCTGTAAGGCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032580
HES7 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 7 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-268s21c1
Sequence:CCGGAGCTGCTACTTGTCCGGTTTCCTCGAGGAAACCGGACAAGTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-81s21c1
Sequence:CCGGCATCAACCGCAGCCTGGAAGACTCGAGTCTTCCAGGCTGCGGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032580.2-808s21c1
Sequence:CCGGGGGTGAGATGTGGTCTATATTCTCGAGAATATAGACCACATCTCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-155s21c1
Sequence:CCGGAGCTGGAGAAAGCGGAGATATCTCGAGATATCTCCGCTTTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-39s21c1
Sequence:CCGGCAAGATGCTCAAGCCGCTTGTCTCGAGACAAGCGGCTTGAGCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032580
HES7 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 7 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-268s21c1
Sequence:CCGGAGCTGCTACTTGTCCGGTTTCCTCGAGGAAACCGGACAAGTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-81s21c1
Sequence:CCGGCATCAACCGCAGCCTGGAAGACTCGAGTCTTCCAGGCTGCGGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032580.2-808s21c1
Sequence:CCGGGGGTGAGATGTGGTCTATATTCTCGAGAATATAGACCACATCTCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-155s21c1
Sequence:CCGGAGCTGGAGAAAGCGGAGATATCTCGAGATATCTCCGCTTTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-39s21c1
Sequence:CCGGCAAGATGCTCAAGCCGCTTGTCTCGAGACAAGCGGCTTGAGCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032580
HES7 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 7 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-268s21c1
Sequence:CCGGAGCTGCTACTTGTCCGGTTTCCTCGAGGAAACCGGACAAGTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-81s21c1
Sequence:CCGGCATCAACCGCAGCCTGGAAGACTCGAGTCTTCCAGGCTGCGGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032580.2-808s21c1
Sequence:CCGGGGGTGAGATGTGGTCTATATTCTCGAGAATATAGACCACATCTCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-155s21c1
Sequence:CCGGAGCTGGAGAAAGCGGAGATATCTCGAGATATCTCCGCTTTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032580.2-39s21c1
Sequence:CCGGCAAGATGCTCAAGCCGCTTGTCTCGAGACAAGCGGCTTGAGCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)