EMAIL THIS PAGE TO A FRIEND

HESX1

HESX homeobox 1

44 Gene Product Result for
Synonyms: ANF CPHD5 RPX
UniProtKB ID: Q9UBX0, Q52LC5, Q99667
Gene ID:
Human(8820) Summary: This gene encodes a conserved homeobox protein that is a transcriptional repressor in the developing forebrain and pituitary gland. Mutations in this gene are associated with septooptic dysplasia, HESX1-related growth hormone deficiency, and combined pituitary hormone deficiency. [provided by RefSeq, Jul 2008]
Mouse(15209) homeobox gene expressed in ES cells
Rat(498575) HESX homeobox 1
naked mole-rat(101703704) HESX homeobox 1
sheep(101103514) HESX homeobox 1
Zebrafish(30620) homeo box (expressed in ES cells) 1
cow(781811) HESX homeobox 1
domestic cat(101096709) HESX homeobox 1
dog(484718) HESX homeobox 1
chicken(395864) HESX homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003865 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003865 Rosetta Predictions human pricing
NM_001109106 Rosetta Predictions rat pricing
NM_010420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047770 predicted 577
2 SASI_Hs01_00047771 predicted 482
3 SASI_Hs01_00047772 predicted 412
4 SASI_Hs01_00047773 predicted 535
5 SASI_Hs01_00047774 predicted 481
6 SASI_Hs01_00047775 predicted 487
7 SASI_Hs01_00047776 predicted 635
8 SASI_Hs01_00047777 predicted 402
9 SASI_Hs01_00047779 predicted 567
10 SASI_Hs02_00336444 predicted 486
11 SASI_Hs01_00047778 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245190 predicted 596
2 SASI_Rn02_00245191 predicted 453
3 SASI_Rn02_00245192 predicted 741
4 SASI_Rn02_00245193 predicted 926
5 SASI_Rn02_00245194 predicted 886
6 SASI_Rn02_00245195 predicted 789
7 SASI_Rn02_00245196 predicted 881
8 SASI_Rn02_00245197 predicted 894
9 SASI_Rn02_00245198 predicted 366
10 SASI_Rn02_00245199 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118915 predicted 589
2 SASI_Mm01_00118916 predicted 864
3 SASI_Mm01_00118917 predicted 883
4 SASI_Mm01_00118918 predicted 757
5 SASI_Mm01_00118919 predicted 455
6 SASI_Mm01_00118920 predicted 702
7 SASI_Mm01_00118921 predicted 633
8 SASI_Mm01_00118922 predicted 848
9 SASI_Mm01_00118923 predicted 802
10 SASI_Mm01_00118924 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003865
VALIDATED
HESX1 MISSION shRNA Bacterial Glycerol Stock
HESX homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-610s1c1
Sequence:CCGGAGCCTCAGAAAGACTGTCTTTCTCGAGAAAGACAGTCTTTCTGAGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-489s1c1
Sequence:CCGGCAGGGAAAGATGGTAACTTATCTCGAGATAAGTTACCATCTTTCCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-726s1c1
Sequence:CCGGGCTATCCTGGTATCGATATTACTCGAGTAATATCGATACCAGGATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003865.1-497s1c1
Sequence:CCGGGATGGTAACTTATGTCTACATCTCGAGATGTAGACATAAGTTACCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-658s1c1
Sequence:CCGGCCGAAGACCAAGAACTGCTTTCTCGAGAAAGCAGTTCTTGGTCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-831s21c1
Sequence:CCGGCCCATAGAGAATCACAGTTTCCTCGAGGAAACTGTGATTCTCTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-430s21c1
Sequence:CCGGGAAAGACTGTGTTCCATTAATCTCGAGATTAATGGAACACAGTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-573s21c1
Sequence:CCGGCAGAAGAAAGAGCTTCGAAATCTCGAGATTTCGAAGCTCTTTCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-876s21c1
Sequence:CCGGCAAATCTGCTGGAATAGATAGCTCGAGCTATCTATTCCAGCAGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003865.2-937s21c1
Sequence:CCGGGAAGAATCAGTGGAAATATTACTCGAGTAATATTTCCACTGATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003865
VALIDATED
HESX1 MISSION shRNA shRNA Plasmid DNA
HESX homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-610s1c1
Sequence:CCGGAGCCTCAGAAAGACTGTCTTTCTCGAGAAAGACAGTCTTTCTGAGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-489s1c1
Sequence:CCGGCAGGGAAAGATGGTAACTTATCTCGAGATAAGTTACCATCTTTCCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-726s1c1
Sequence:CCGGGCTATCCTGGTATCGATATTACTCGAGTAATATCGATACCAGGATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003865.1-497s1c1
Sequence:CCGGGATGGTAACTTATGTCTACATCTCGAGATGTAGACATAAGTTACCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-658s1c1
Sequence:CCGGCCGAAGACCAAGAACTGCTTTCTCGAGAAAGCAGTTCTTGGTCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-831s21c1
Sequence:CCGGCCCATAGAGAATCACAGTTTCCTCGAGGAAACTGTGATTCTCTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-430s21c1
Sequence:CCGGGAAAGACTGTGTTCCATTAATCTCGAGATTAATGGAACACAGTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-573s21c1
Sequence:CCGGCAGAAGAAAGAGCTTCGAAATCTCGAGATTTCGAAGCTCTTTCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-876s21c1
Sequence:CCGGCAAATCTGCTGGAATAGATAGCTCGAGCTATCTATTCCAGCAGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003865.2-937s21c1
Sequence:CCGGGAAGAATCAGTGGAAATATTACTCGAGTAATATTTCCACTGATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003865
VALIDATED
HESX1 MISSION shRNA Lentiviral Transduction Particles
HESX homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-610s1c1
Sequence:CCGGAGCCTCAGAAAGACTGTCTTTCTCGAGAAAGACAGTCTTTCTGAGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-489s1c1
Sequence:CCGGCAGGGAAAGATGGTAACTTATCTCGAGATAAGTTACCATCTTTCCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-726s1c1
Sequence:CCGGGCTATCCTGGTATCGATATTACTCGAGTAATATCGATACCAGGATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003865.1-497s1c1
Sequence:CCGGGATGGTAACTTATGTCTACATCTCGAGATGTAGACATAAGTTACCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003865.1-658s1c1
Sequence:CCGGCCGAAGACCAAGAACTGCTTTCTCGAGAAAGCAGTTCTTGGTCTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-831s21c1
Sequence:CCGGCCCATAGAGAATCACAGTTTCCTCGAGGAAACTGTGATTCTCTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-430s21c1
Sequence:CCGGGAAAGACTGTGTTCCATTAATCTCGAGATTAATGGAACACAGTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-573s21c1
Sequence:CCGGCAGAAGAAAGAGCTTCGAAATCTCGAGATTTCGAAGCTCTTTCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003865.2-876s21c1
Sequence:CCGGCAAATCTGCTGGAATAGATAGCTCGAGCTATCTATTCCAGCAGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003865.2-937s21c1
Sequence:CCGGGAAGAATCAGTGGAAATATTACTCGAGTAATATTTCCACTGATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010420
VALIDATED
HESX1 MISSION shRNA Bacterial Glycerol Stock
HESX homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010420.1-864s1c1
Sequence:CCGGTCACAGTTTCTAATGGCGAAACTCGAGTTTCGCCATTAGAAACTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-593s1c1
Sequence:CCGGGCCAGAAGAAAGGGCTCCGAACTCGAGTTCGGAGCCCTTTCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-415s1c1
Sequence:CCGGCCTTCTCAATTGAGAGCATTTCTCGAGAAATGCTCTCAATTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-798s1c1
Sequence:CCGGGAGGAAGACAGAATCCAGATTCTCGAGAATCTGGATTCTGTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-709s1c1
Sequence:CCGGACCAGGTCGAAGTATTGGAAACTCGAGTTTCCAATACTTCGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-599s21c1
Sequence:CCGGGAAGAAAGGGCTCCGAAATATCTCGAGATATTTCGGAGCCCTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-457s21c1
Sequence:CCGGAGATTGTACAACGTCAGTAAGCTCGAGCTTACTGACGTTGTACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010420.2-973s21c1
Sequence:CCGGTGGAAATTCCAAGTACTTAAACTCGAGTTTAAGTACTTGGAATTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-855s21c1
Sequence:CCGGCCCGTAGAGAATCACAGTTTCCTCGAGGAAACTGTGATTCTCTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-706s21c1
Sequence:CCGGCCAGAACCAGGTCGAAGTATTCTCGAGAATACTTCGACCTGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010420
VALIDATED
HESX1 MISSION shRNA shRNA Plasmid DNA
HESX homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010420.1-864s1c1
Sequence:CCGGTCACAGTTTCTAATGGCGAAACTCGAGTTTCGCCATTAGAAACTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-593s1c1
Sequence:CCGGGCCAGAAGAAAGGGCTCCGAACTCGAGTTCGGAGCCCTTTCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-415s1c1
Sequence:CCGGCCTTCTCAATTGAGAGCATTTCTCGAGAAATGCTCTCAATTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-798s1c1
Sequence:CCGGGAGGAAGACAGAATCCAGATTCTCGAGAATCTGGATTCTGTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-709s1c1
Sequence:CCGGACCAGGTCGAAGTATTGGAAACTCGAGTTTCCAATACTTCGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-599s21c1
Sequence:CCGGGAAGAAAGGGCTCCGAAATATCTCGAGATATTTCGGAGCCCTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-457s21c1
Sequence:CCGGAGATTGTACAACGTCAGTAAGCTCGAGCTTACTGACGTTGTACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010420.2-973s21c1
Sequence:CCGGTGGAAATTCCAAGTACTTAAACTCGAGTTTAAGTACTTGGAATTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-855s21c1
Sequence:CCGGCCCGTAGAGAATCACAGTTTCCTCGAGGAAACTGTGATTCTCTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-706s21c1
Sequence:CCGGCCAGAACCAGGTCGAAGTATTCTCGAGAATACTTCGACCTGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010420
VALIDATED
HESX1 MISSION shRNA Lentiviral Transduction Particles
HESX homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010420.1-864s1c1
Sequence:CCGGTCACAGTTTCTAATGGCGAAACTCGAGTTTCGCCATTAGAAACTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-593s1c1
Sequence:CCGGGCCAGAAGAAAGGGCTCCGAACTCGAGTTCGGAGCCCTTTCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-415s1c1
Sequence:CCGGCCTTCTCAATTGAGAGCATTTCTCGAGAAATGCTCTCAATTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-798s1c1
Sequence:CCGGGAGGAAGACAGAATCCAGATTCTCGAGAATCTGGATTCTGTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010420.1-709s1c1
Sequence:CCGGACCAGGTCGAAGTATTGGAAACTCGAGTTTCCAATACTTCGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-599s21c1
Sequence:CCGGGAAGAAAGGGCTCCGAAATATCTCGAGATATTTCGGAGCCCTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-457s21c1
Sequence:CCGGAGATTGTACAACGTCAGTAAGCTCGAGCTTACTGACGTTGTACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010420.2-973s21c1
Sequence:CCGGTGGAAATTCCAAGTACTTAAACTCGAGTTTAAGTACTTGGAATTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-855s21c1
Sequence:CCGGCCCGTAGAGAATCACAGTTTCCTCGAGGAAACTGTGATTCTCTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010420.2-706s21c1
Sequence:CCGGCCAGAACCAGGTCGAAGTATTCTCGAGAATACTTCGACCTGGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)