EMAIL THIS PAGE TO A FRIEND

HEXA-AS1

HEXA antisense RNA 1

42 Gene Product Result for
Synonyms: C15orf34
Species: Human HEXA-AS1(80072)
UniProtKB ID: Q9H8Q6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037223 Rosetta Predictions human pricing
XR_040821 Rosetta Predictions human pricing
XR_040822 Rosetta Predictions human pricing
XR_040823 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156627 predicted 271
2 SASI_Hs01_00156628 predicted 440
3 SASI_Hs01_00156629 predicted 245
4 SASI_Hs01_00156630 predicted 340
5 SASI_Hs01_00156631 predicted 279
6 SASI_Hs01_00156632 predicted 234
7 SASI_Hs01_00156633 predicted 454
8 SASI_Hs01_00156634 predicted 345
9 SASI_Hs01_00156635 predicted 1112
10 SASI_Hs01_00156636 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522227 predicted 453
2 SASI_Hs02_00522228 predicted 278
3 SASI_Hs02_00522229 predicted 519
4 SASI_Hs02_00522230 predicted 278
5 SASI_Hs02_00522231 predicted 469
6 SASI_Hs02_00522232 predicted 580
7 SASI_Hs02_00522233 predicted 346
8 SASI_Hs02_00522234 predicted 584
9 SASI_Hs02_00522235 predicted 376
10 SASI_Hs02_00522236 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522237 predicted 453
2 SASI_Hs02_00522238 predicted 282
3 SASI_Hs02_00522239 predicted 522
4 SASI_Hs02_00522240 predicted 280
5 SASI_Hs02_00522241 predicted 460
6 SASI_Hs02_00522242 predicted 577
7 SASI_Hs02_00522243 predicted 349
8 SASI_Hs02_00522244 predicted 588
9 SASI_Hs02_00522245 predicted 378
10 SASI_Hs02_00522246 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522247 predicted 457
2 SASI_Hs02_00522248 predicted 282
3 SASI_Hs02_00522249 predicted 522
4 SASI_Hs02_00522250 predicted 282
5 SASI_Hs02_00522251 predicted 469
6 SASI_Hs02_00522252 predicted 584
7 SASI_Hs02_00522253 predicted 345
8 SASI_Hs02_00522254 predicted 586
9 SASI_Hs02_00522255 predicted 378
10 SASI_Hs02_00522256 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037223
HEXA-AS1 MISSION shRNA Bacterial Glycerol Stock
HEXA antisense RNA 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037223.1-1211s1c1
Sequence:CCGGGCTTGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037223.1-393s1c1
Sequence:CCGGGATGGAGAGTGCTCAGAGATACTCGAGTATCTCTGAGCACTCTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037223.1-866s1c1
Sequence:CCGGGCATGATAACACATCCCTGTACTCGAGTACAGGGATGTGTTATCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037223
HEXA-AS1 MISSION shRNA shRNA Plasmid DNA
HEXA antisense RNA 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037223.1-1211s1c1
Sequence:CCGGGCTTGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037223.1-393s1c1
Sequence:CCGGGATGGAGAGTGCTCAGAGATACTCGAGTATCTCTGAGCACTCTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037223.1-866s1c1
Sequence:CCGGGCATGATAACACATCCCTGTACTCGAGTACAGGGATGTGTTATCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037223
HEXA-AS1 MISSION shRNA Lentiviral Transduction Particles
HEXA antisense RNA 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037223.1-1211s1c1
Sequence:CCGGGCTTGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037223.1-393s1c1
Sequence:CCGGGATGGAGAGTGCTCAGAGATACTCGAGTATCTCTGAGCACTCTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037223.1-866s1c1
Sequence:CCGGGCATGATAACACATCCCTGTACTCGAGTACAGGGATGTGTTATCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)