EMAIL THIS PAGE TO A FRIEND

HEXA

hexosaminidase A (alpha polypeptide)

107 Gene Product Result for
Synonyms: TSD
UniProtKB ID: P06865, Q53HS8, Q6AI32
Gene ID:
Human(3073) Summary: This gene encodes the alpha subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Alpha subunit gene mutations lead to Tay-Sachs disease (GM2-gangliosidosis type I). [provided by RefSeq, Jul 2009]
Mouse(15211) hexosaminidase A
Rat(300757) hexosaminidase A
Zebrafish(323613) hexosaminidase A (alpha polypeptide)
chicken(415320) hexosaminidase A (alpha polypeptide)
cow(504468) hexosaminidase A (alpha polypeptide)
Horse(100063584) hexosaminidase A (alpha polypeptide)
domestic cat(101091627) hexosaminidase A (alpha polypeptide)
dog(487633) hexosaminidase A (alpha polypeptide)
sheep(100145856) hexosaminidase A (alpha polypeptide)
Domestic Rabbit(100008950) hexosaminidase A (alpha polypeptide)
domestic guinea pig(100712955) hexosaminidase A (alpha polypeptide)
naked mole-rat(101718368) hexosaminidase A (alpha polypeptide)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1502 Human HEXA ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220171 MISSION® esiRNA esiRNA targeting human HEXA human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000520 Rosetta Predictions human pricing
NM_001004443 Rosetta Predictions rat pricing
NM_010421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302710 predicted 631
2 SASI_Hs02_00302711 predicted 193
3 SASI_Hs01_00188344 predicted 964
4 SASI_Hs01_00188346 predicted 1351
5 SASI_Hs02_00302712 predicted 211
6 SASI_Hs01_00188348 predicted 1268
7 SASI_Hs01_00188349 predicted 1266
8 SASI_Hs02_00302713 predicted 1179
9 SASI_Hs02_00302714 predicted 1385
10 SASI_Hs02_00302715 predicted 358
11 SASI_Hs01_00188341 predicted 916
12 SASI_Hs01_00188342 predicted 379
13 SASI_Hs01_00188343 predicted 1510
14 SASI_Hs01_00188345 predicted 482
15 SASI_Hs01_00188347 predicted 1479
16 SASI_Hs01_00188350 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081155 predicted 754
2 SASI_Rn02_00198346 predicted 1164
3 SASI_Rn01_00081156 predicted 699
4 SASI_Rn01_00081157 predicted 1114
5 SASI_Rn01_00081158 predicted 445
6 SASI_Rn01_00081159 predicted 917
7 SASI_Rn01_00081160 predicted 351
8 SASI_Rn01_00081161 predicted 1498
9 SASI_Rn01_00081162 predicted 1502
10 SASI_Rn01_00081163 predicted 908
11 SASI_Rn01_00081164 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128806 predicted 1188
2 SASI_Mm01_00128807 predicted 1609
3 SASI_Mm02_00318566 predicted 1375
4 SASI_Mm01_00128808 predicted 1238
5 SASI_Mm01_00128809 predicted 361
6 SASI_Mm01_00128810 predicted 1144
7 SASI_Mm01_00128811 predicted 475
8 SASI_Mm01_00128812 predicted 527
9 SASI_Mm01_00128813 predicted 379
10 SASI_Mm01_00128814 predicted 1203
11 SASI_Mm01_00128815 predicted 1088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010421
VALIDATED
HEXA MISSION shRNA Bacterial Glycerol Stock
hexosaminidase A (alpha polypeptide)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-413s21c3
Sequence:CCGGCCATTAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-1173s21c5
Sequence:CCGGGCAGGAGGTATTTGATAATAACTCGAGTTATTATCAAATACCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010421.4-1662s21c2
Sequence:CCGGCCCAGGAGGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACCTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-1663s1c1
Sequence:CCGGCCCAGGAGGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACCTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010421.3-577s1c1
Sequence:CCGGGCTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010421.3-1174s1c1
Sequence:CCGGGCAGGAGGTATTTGATAATAACTCGAGTTATTATCAAATACCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-414s1c1
Sequence:CCGGCCATTAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-576s21c4
Sequence:CCGGGCTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-1518s21c3
Sequence:CCGGCCTGACAACTAATATAGACTTCTCGAGAAGTCTATATTAGTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-1519s1c1
Sequence:CCGGCCTGACAACTAATATAGACTTCTCGAGAAGTCTATATTAGTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010421
VALIDATED
HEXA MISSION shRNA shRNA Plasmid DNA
hexosaminidase A (alpha polypeptide)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-413s21c3
Sequence:CCGGCCATTAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-1173s21c5
Sequence:CCGGGCAGGAGGTATTTGATAATAACTCGAGTTATTATCAAATACCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010421.4-1662s21c2
Sequence:CCGGCCCAGGAGGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACCTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-1663s1c1
Sequence:CCGGCCCAGGAGGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACCTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010421.3-577s1c1
Sequence:CCGGGCTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010421.3-1174s1c1
Sequence:CCGGGCAGGAGGTATTTGATAATAACTCGAGTTATTATCAAATACCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-414s1c1
Sequence:CCGGCCATTAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-576s21c4
Sequence:CCGGGCTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-1518s21c3
Sequence:CCGGCCTGACAACTAATATAGACTTCTCGAGAAGTCTATATTAGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-1519s1c1
Sequence:CCGGCCTGACAACTAATATAGACTTCTCGAGAAGTCTATATTAGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010421
VALIDATED
HEXA MISSION shRNA Lentiviral Transduction Particles
hexosaminidase A (alpha polypeptide)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-413s21c3
Sequence:CCGGCCATTAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-1173s21c5
Sequence:CCGGGCAGGAGGTATTTGATAATAACTCGAGTTATTATCAAATACCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010421.4-1662s21c2
Sequence:CCGGCCCAGGAGGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACCTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-1663s1c1
Sequence:CCGGCCCAGGAGGTTGCTGTCCTTTCTCGAGAAAGGACAGCAACCTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010421.3-577s1c1
Sequence:CCGGGCTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010421.3-1174s1c1
Sequence:CCGGGCAGGAGGTATTTGATAATAACTCGAGTTATTATCAAATACCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-414s1c1
Sequence:CCGGCCATTAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-576s21c4
Sequence:CCGGGCTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010421.4-1518s21c3
Sequence:CCGGCCTGACAACTAATATAGACTTCTCGAGAAGTCTATATTAGTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010421.3-1519s1c1
Sequence:CCGGCCTGACAACTAATATAGACTTCTCGAGAAGTCTATATTAGTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000520
VALIDATED
HEXA MISSION shRNA Bacterial Glycerol Stock
hexosaminidase A (alpha polypeptide)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-776s21c1
Sequence:CCGGTGGATGTCATGGCGTACAATACTCGAGTATTGTACGCCATGACATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-318s21c1
Sequence:CCGGCGTCCTTTACCCGAACAACTTCTCGAGAAGTTGTTCGGGTAAAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000520.4-2222s21c1
Sequence:CCGGTATCTCCAAGGCGTTGGTATACTCGAGTATACCAACGCCTTGGAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-536s21c1
Sequence:CCGGTGGAGTCAGTGGAGAATTATACTCGAGTATAATTCTCCACTGACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-1081s21c1
Sequence:CCGGCCCAGTCTCAATAATACCTATCTCGAGATAGGTATTATTGAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000520.2-382s1c1
Sequence:CCGGCCATAAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-137s1c1
Sequence:CCGGCGTCCTTTACCCGAACAACTTCTCGAGAAGTTGTTCGGGTAAAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-1202s1c1
Sequence:CCGGGCGAGAGGATATTCCAGTGAACTCGAGTTCACTGGAATATCCTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-900s1c1
Sequence:CCGGCCCAGTCTCAATAATACCTATCTCGAGATAGGTATTATTGAGACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-545s1c1
Sequence:CCGGGTTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000520
VALIDATED
HEXA MISSION shRNA shRNA Plasmid DNA
hexosaminidase A (alpha polypeptide)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-776s21c1
Sequence:CCGGTGGATGTCATGGCGTACAATACTCGAGTATTGTACGCCATGACATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-318s21c1
Sequence:CCGGCGTCCTTTACCCGAACAACTTCTCGAGAAGTTGTTCGGGTAAAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000520.4-2222s21c1
Sequence:CCGGTATCTCCAAGGCGTTGGTATACTCGAGTATACCAACGCCTTGGAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-536s21c1
Sequence:CCGGTGGAGTCAGTGGAGAATTATACTCGAGTATAATTCTCCACTGACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-1081s21c1
Sequence:CCGGCCCAGTCTCAATAATACCTATCTCGAGATAGGTATTATTGAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000520.2-382s1c1
Sequence:CCGGCCATAAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-137s1c1
Sequence:CCGGCGTCCTTTACCCGAACAACTTCTCGAGAAGTTGTTCGGGTAAAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-1202s1c1
Sequence:CCGGGCGAGAGGATATTCCAGTGAACTCGAGTTCACTGGAATATCCTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-900s1c1
Sequence:CCGGCCCAGTCTCAATAATACCTATCTCGAGATAGGTATTATTGAGACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-545s1c1
Sequence:CCGGGTTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000520
VALIDATED
HEXA MISSION shRNA Lentiviral Transduction Particles
hexosaminidase A (alpha polypeptide)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-776s21c1
Sequence:CCGGTGGATGTCATGGCGTACAATACTCGAGTATTGTACGCCATGACATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-318s21c1
Sequence:CCGGCGTCCTTTACCCGAACAACTTCTCGAGAAGTTGTTCGGGTAAAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000520.4-2222s21c1
Sequence:CCGGTATCTCCAAGGCGTTGGTATACTCGAGTATACCAACGCCTTGGAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-536s21c1
Sequence:CCGGTGGAGTCAGTGGAGAATTATACTCGAGTATAATTCTCCACTGACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000520.4-1081s21c1
Sequence:CCGGCCCAGTCTCAATAATACCTATCTCGAGATAGGTATTATTGAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000520.2-382s1c1
Sequence:CCGGCCATAAATGATGACCAGTGTTCTCGAGAACACTGGTCATCATTTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-137s1c1
Sequence:CCGGCGTCCTTTACCCGAACAACTTCTCGAGAAGTTGTTCGGGTAAAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-1202s1c1
Sequence:CCGGGCGAGAGGATATTCCAGTGAACTCGAGTTCACTGGAATATCCTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-900s1c1
Sequence:CCGGCCCAGTCTCAATAATACCTATCTCGAGATAGGTATTATTGAGACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000520.2-545s1c1
Sequence:CCGGGTTGGATACATCTCGCCATTACTCGAGTAATGGCGAGATGTATCCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)