EMAIL THIS PAGE TO A FRIEND

HEXDC

hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing

46 Gene Product Result for
UniProtKB ID: Q8WVB3, B7UUP6, Q8IYN4, Q8TE81
Gene ID:
Mouse(238023) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Rat(100216475) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
sheep(101110345) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
domestic guinea pig(100718009) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
naked mole-rat(101705234) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Zebrafish(565372) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
chicken(417343) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
dog(491680) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
cow(506184) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Horse(100056795) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
domestic cat(101082793) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
chicken(770994) hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173620 Rosetta Predictions human pricing
NM_001001333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101315 predicted 849
2 SASI_Hs02_00368494 predicted 626
3 SASI_Hs01_00101316 predicted 924
4 SASI_Hs02_00368495 predicted 661
5 SASI_Hs02_00368496 predicted 624
6 SASI_Hs01_00101317 predicted 847
7 SASI_Hs02_00368497 predicted 647
8 SASI_Hs02_00368498 predicted 686
9 SASI_Hs02_00368499 predicted 605
10 SASI_Hs02_00368500 predicted 668
11 SASI_Hs01_00101318 predicted 534
12 SASI_Hs01_00101319 predicted 916
13 SASI_Hs01_00101320 predicted 785
14 SASI_Hs01_00101321 predicted 915
15 SASI_Hs01_00101322 predicted 1280
16 SASI_Hs01_00101323 predicted 1084
17 SASI_Hs01_00101324 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190269 predicted 377
2 SASI_Mm01_00190270 predicted 1421
3 SASI_Mm01_00190271 predicted 1487
4 SASI_Mm02_00286130 predicted 389
5 SASI_Mm01_00190272 predicted 1430
6 SASI_Mm01_00190274 predicted 1425
7 SASI_Mm01_00190275 predicted 1367
8 SASI_Mm01_00190276 predicted 1063
9 SASI_Mm01_00190277 predicted 1310
10 SASI_Mm01_00190278 predicted 1431
11 SASI_Mm01_00190273 predicted 1261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173620
HEXDC MISSION shRNA Bacterial Glycerol Stock
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-448s21c1
Sequence:CCGGTAGTTCATTTAGACCTTAAAGCTCGAGCTTTAAGGTCTAAATGAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-1421s21c1
Sequence:CCGGAGCGAAAGTGGAGAACCTTCTCTCGAGAGAAGGTTCTCCACTTTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-1312s21c1
Sequence:CCGGAGAGGTACGACCACTACTCTGCTCGAGCAGAGTAGTGGTCGTACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-633s21c1
Sequence:CCGGTTGCATCTGGCTGGACTCAATCTCGAGATTGAGTCCAGCCAGATGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-1080s1c1
Sequence:CCGGGAGGATTTGATGAAGATGTTACTCGAGTAACATCTTCATCAAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-539s1c1
Sequence:CCGGGATGAGGTCTATTACCTCGGACTCGAGTCCGAGGTAATAGACCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-1076s1c1
Sequence:CCGGCGCGGAGGATTTGATGAAGATCTCGAGATCTTCATCAAATCCTCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-610s1c1
Sequence:CCGGGAAGTTGTGCCTGTCACACATCTCGAGATGTGTGACAGGCACAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173620
HEXDC MISSION shRNA shRNA Plasmid DNA
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-448s21c1
Sequence:CCGGTAGTTCATTTAGACCTTAAAGCTCGAGCTTTAAGGTCTAAATGAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-1421s21c1
Sequence:CCGGAGCGAAAGTGGAGAACCTTCTCTCGAGAGAAGGTTCTCCACTTTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-1312s21c1
Sequence:CCGGAGAGGTACGACCACTACTCTGCTCGAGCAGAGTAGTGGTCGTACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-633s21c1
Sequence:CCGGTTGCATCTGGCTGGACTCAATCTCGAGATTGAGTCCAGCCAGATGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-1080s1c1
Sequence:CCGGGAGGATTTGATGAAGATGTTACTCGAGTAACATCTTCATCAAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-539s1c1
Sequence:CCGGGATGAGGTCTATTACCTCGGACTCGAGTCCGAGGTAATAGACCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-1076s1c1
Sequence:CCGGCGCGGAGGATTTGATGAAGATCTCGAGATCTTCATCAAATCCTCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-610s1c1
Sequence:CCGGGAAGTTGTGCCTGTCACACATCTCGAGATGTGTGACAGGCACAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173620
HEXDC MISSION shRNA Lentiviral Transduction Particles
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-448s21c1
Sequence:CCGGTAGTTCATTTAGACCTTAAAGCTCGAGCTTTAAGGTCTAAATGAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-1421s21c1
Sequence:CCGGAGCGAAAGTGGAGAACCTTCTCTCGAGAGAAGGTTCTCCACTTTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-1312s21c1
Sequence:CCGGAGAGGTACGACCACTACTCTGCTCGAGCAGAGTAGTGGTCGTACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173620.2-633s21c1
Sequence:CCGGTTGCATCTGGCTGGACTCAATCTCGAGATTGAGTCCAGCCAGATGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-1080s1c1
Sequence:CCGGGAGGATTTGATGAAGATGTTACTCGAGTAACATCTTCATCAAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-539s1c1
Sequence:CCGGGATGAGGTCTATTACCTCGGACTCGAGTCCGAGGTAATAGACCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-1076s1c1
Sequence:CCGGCGCGGAGGATTTGATGAAGATCTCGAGATCTTCATCAAATCCTCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173620.1-610s1c1
Sequence:CCGGGAAGTTGTGCCTGTCACACATCTCGAGATGTGTGACAGGCACAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001333
HEXDC MISSION shRNA Bacterial Glycerol Stock
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1324s1c1
Sequence:CCGGCGTCACACAAATTAGTCTCCACTCGAGTGGAGACTAATTTGTGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1436s1c1
Sequence:CCGGCCAGTTATGATCCAGCACATACTCGAGTATGTGCTGGATCATAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001333.1-1714s1c1
Sequence:CCGGCACCAAGATTTCTGTTTCACTCTCGAGAGTGAAACAGAAATCTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-806s1c1
Sequence:CCGGGAGCACCACATCAGAAACCATCTCGAGATGGTTTCTGATGTGGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1259s1c1
Sequence:CCGGCTGGAGATAGCGGATACTGTACTCGAGTACAGTATCCGCTATCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001333
HEXDC MISSION shRNA shRNA Plasmid DNA
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1324s1c1
Sequence:CCGGCGTCACACAAATTAGTCTCCACTCGAGTGGAGACTAATTTGTGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1436s1c1
Sequence:CCGGCCAGTTATGATCCAGCACATACTCGAGTATGTGCTGGATCATAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001333.1-1714s1c1
Sequence:CCGGCACCAAGATTTCTGTTTCACTCTCGAGAGTGAAACAGAAATCTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-806s1c1
Sequence:CCGGGAGCACCACATCAGAAACCATCTCGAGATGGTTTCTGATGTGGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1259s1c1
Sequence:CCGGCTGGAGATAGCGGATACTGTACTCGAGTACAGTATCCGCTATCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001333
HEXDC MISSION shRNA Lentiviral Transduction Particles
hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1324s1c1
Sequence:CCGGCGTCACACAAATTAGTCTCCACTCGAGTGGAGACTAATTTGTGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1436s1c1
Sequence:CCGGCCAGTTATGATCCAGCACATACTCGAGTATGTGCTGGATCATAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001333.1-1714s1c1
Sequence:CCGGCACCAAGATTTCTGTTTCACTCTCGAGAGTGAAACAGAAATCTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-806s1c1
Sequence:CCGGGAGCACCACATCAGAAACCATCTCGAGATGGTTTCTGATGTGGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001333.1-1259s1c1
Sequence:CCGGCTGGAGATAGCGGATACTGTACTCGAGTACAGTATCCGCTATCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)