EMAIL THIS PAGE TO A FRIEND

HEXIM1

hexamethylene bis-acetamide inducible 1

244 Gene Product Result for
Synonyms: CLP1 EDG1 HIS1 MAQ1
UniProtKB ID: O94992, B2R8Y5
Gene ID:
Human(10614) Summary: Expression of this gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. This gene has no introns. [provided by RefSeq, Jul 2008]
Mouse(192231) hexamethylene bis-acetamide inducible 1
Rat(498008) hexamethylene bis-acetamide inducible 1
Zebrafish(562319) hexamethylene bis-acetamide inducible 1
chicken(771191) hexamethylene bis-acetamide inducible 1
dog(606811) hexamethylene bis-acetamide inducible 1
domestic cat(101083220) hexamethylene bis-acetamide inducible 1
cow(539696) hexamethylene bis-acetamide inducible 1
chicken(100857796) hexamethylene bis-acetamide inducible 1
domestic guinea pig(100724358) hexamethylene bis-acetamide inducible 1
naked mole-rat(101717138) hexamethylene bis-acetamide inducible 1
sheep(101118287) hexamethylene bis-acetamide inducible 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006460 Rosetta Predictions human pricing
NM_001025136 Rosetta Predictions rat pricing
NM_138753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204778 predicted 2926
2 SASI_Hs01_00204779 predicted 2352
3 SASI_Hs01_00204781 predicted 1994
4 SASI_Hs01_00204782 predicted 2351
5 SASI_Hs01_00204786 predicted 2329
6 SASI_Hs02_00341608 predicted 2938
7 SASI_Hs02_00341609 predicted 2171
8 SASI_Hs02_00341610 predicted 2346
9 SASI_Hs02_00341611 predicted 2001
10 SASI_Hs02_00341612 predicted 2421
11 SASI_Hs01_00204780 predicted 2583
12 SASI_Hs01_00204783 predicted 2590
13 SASI_Hs01_00204784 predicted 2937
14 SASI_Hs01_00204785 predicted 2670
15 SASI_Hs01_00204787 predicted 2723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040469 predicted 1768
2 SASI_Rn01_00040471 predicted 1132
3 SASI_Rn02_00203060 predicted 1642
4 SASI_Rn01_00040473 predicted 1211
5 SASI_Rn01_00040474 predicted 879
6 SASI_Rn01_00040475 predicted 1358
7 SASI_Rn01_00040476 predicted 1490
8 SASI_Rn01_00040477 predicted 774
9 SASI_Rn01_00040478 predicted 1006
10 SASI_Rn02_00203061 predicted 1310
11 SASI_Rn01_00040470 predicted 1710
12 SASI_Rn01_00040472 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061895 predicted 1711
2 SASI_Mm02_00339803 predicted 1069
3 SASI_Mm01_00061896 predicted 631
4 SASI_Mm02_00339804 predicted 1184
5 SASI_Mm01_00061898 predicted 817
6 SASI_Mm01_00061899 predicted 1434
7 SASI_Mm01_00061900 predicted 631
8 SASI_Mm01_00061901 predicted 599
9 SASI_Mm01_00061902 predicted 820
10 SASI_Mm02_00339805 predicted 1372
11 SASI_Mm01_00061897 predicted 661
12 SASI_Mm01_00061903 predicted 1641
13 SASI_Mm01_00061904 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006460
VALIDATED
HEXIM1 MISSION shRNA Bacterial Glycerol Stock
hexamethylene bis-acetamide inducible 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-1909s21c1
Sequence:CCGGAGCCTCAAACTAGCAACTGTACTCGAGTACAGTTGCTAGTTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-2942s21c1
Sequence:CCGGGTTTGGAGACTAGACTGAAACCTCGAGGTTTCAGTCTAGTCTCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-2578s21c1
Sequence:CCGGACACCAGCGATGACGACTTCACTCGAGTGAAGTCGTCATCGCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006460.2-2357s21c1
Sequence:CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGTACGGTTTCCAATGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006460.2-4137s21c1
Sequence:CCGGCCCTATTCTAAATCGCTTAAACTCGAGTTTAAGCGATTTAGAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006460.1-1175s1c1
Sequence:CCGGGCATTGGAAACCGTACTACAACTCGAGTTGTAGTACGGTTTCCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006460.1-2067s1c1
Sequence:CCGGCCCTCCTTAAACGGAGCTATACTCGAGTATAGCTCCGTTTAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006460.1-1292s1c1
Sequence:CCGGGCCCTATAACACCACGCAGTTCTCGAGAACTGCGTGGTGTTATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006460.1-1172s1c1
Sequence:CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGTACGGTTTCCAATGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006460
VALIDATED
HEXIM1 MISSION shRNA shRNA Plasmid DNA
hexamethylene bis-acetamide inducible 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-1909s21c1
Sequence:CCGGAGCCTCAAACTAGCAACTGTACTCGAGTACAGTTGCTAGTTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-2942s21c1
Sequence:CCGGGTTTGGAGACTAGACTGAAACCTCGAGGTTTCAGTCTAGTCTCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-2578s21c1
Sequence:CCGGACACCAGCGATGACGACTTCACTCGAGTGAAGTCGTCATCGCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006460.2-2357s21c1
Sequence:CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGTACGGTTTCCAATGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006460.2-4137s21c1
Sequence:CCGGCCCTATTCTAAATCGCTTAAACTCGAGTTTAAGCGATTTAGAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006460.1-1175s1c1
Sequence:CCGGGCATTGGAAACCGTACTACAACTCGAGTTGTAGTACGGTTTCCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006460.1-2067s1c1
Sequence:CCGGCCCTCCTTAAACGGAGCTATACTCGAGTATAGCTCCGTTTAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006460.1-1292s1c1
Sequence:CCGGGCCCTATAACACCACGCAGTTCTCGAGAACTGCGTGGTGTTATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006460.1-1172s1c1
Sequence:CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGTACGGTTTCCAATGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006460
VALIDATED
HEXIM1 MISSION shRNA Lentiviral Transduction Particles
hexamethylene bis-acetamide inducible 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-1909s21c1
Sequence:CCGGAGCCTCAAACTAGCAACTGTACTCGAGTACAGTTGCTAGTTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-2942s21c1
Sequence:CCGGGTTTGGAGACTAGACTGAAACCTCGAGGTTTCAGTCTAGTCTCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006460.2-2578s21c1
Sequence:CCGGACACCAGCGATGACGACTTCACTCGAGTGAAGTCGTCATCGCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006460.2-2357s21c1
Sequence:CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGTACGGTTTCCAATGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006460.2-4137s21c1
Sequence:CCGGCCCTATTCTAAATCGCTTAAACTCGAGTTTAAGCGATTTAGAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006460.1-1175s1c1
Sequence:CCGGGCATTGGAAACCGTACTACAACTCGAGTTGTAGTACGGTTTCCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006460.1-2067s1c1
Sequence:CCGGCCCTCCTTAAACGGAGCTATACTCGAGTATAGCTCCGTTTAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006460.1-1292s1c1
Sequence:CCGGGCCCTATAACACCACGCAGTTCTCGAGAACTGCGTGGTGTTATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006460.1-1172s1c1
Sequence:CCGGGCGGCATTGGAAACCGTACTACTCGAGTAGTACGGTTTCCAATGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138753
HEXIM1 MISSION shRNA Bacterial Glycerol Stock
hexamethylene bis-acetamide inducible 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1436s21c1
Sequence:CCGGGCAAGCAGGAGCTCATCAAAGCTCGAGCTTTGATGAGCTCCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-823s21c1
Sequence:CCGGACGAATGCCTGTCCAGAATTGCTCGAGCAATTCTGGACAGGCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1059s21c1
Sequence:CCGGCTCAAAGAAGAAGCGGCATTGCTCGAGCAATGCCGCTTCTTCTTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138753.1-2525s1c1
Sequence:CCGGGCCAAGATAAACTTGTGAGAACTCGAGTTCTCACAAGTTTATCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1290s21c1
Sequence:CCGGCGACACCAGCGATGAGGATTTCTCGAGAAATCCTCATCGCTGGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138753.2-2944s21c1
Sequence:CCGGGTGTTTCCTTAGGGCAATTATCTCGAGATAATTGCCCTAAGGAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138753
HEXIM1 MISSION shRNA shRNA Plasmid DNA
hexamethylene bis-acetamide inducible 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1436s21c1
Sequence:CCGGGCAAGCAGGAGCTCATCAAAGCTCGAGCTTTGATGAGCTCCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-823s21c1
Sequence:CCGGACGAATGCCTGTCCAGAATTGCTCGAGCAATTCTGGACAGGCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1059s21c1
Sequence:CCGGCTCAAAGAAGAAGCGGCATTGCTCGAGCAATGCCGCTTCTTCTTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138753.1-2525s1c1
Sequence:CCGGGCCAAGATAAACTTGTGAGAACTCGAGTTCTCACAAGTTTATCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1290s21c1
Sequence:CCGGCGACACCAGCGATGAGGATTTCTCGAGAAATCCTCATCGCTGGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138753.2-2944s21c1
Sequence:CCGGGTGTTTCCTTAGGGCAATTATCTCGAGATAATTGCCCTAAGGAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138753
HEXIM1 MISSION shRNA Lentiviral Transduction Particles
hexamethylene bis-acetamide inducible 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1436s21c1
Sequence:CCGGGCAAGCAGGAGCTCATCAAAGCTCGAGCTTTGATGAGCTCCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-823s21c1
Sequence:CCGGACGAATGCCTGTCCAGAATTGCTCGAGCAATTCTGGACAGGCATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1059s21c1
Sequence:CCGGCTCAAAGAAGAAGCGGCATTGCTCGAGCAATGCCGCTTCTTCTTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138753.1-2525s1c1
Sequence:CCGGGCCAAGATAAACTTGTGAGAACTCGAGTTCTCACAAGTTTATCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138753.2-1290s21c1
Sequence:CCGGCGACACCAGCGATGAGGATTTCTCGAGAAATCCTCATCGCTGGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138753.2-2944s21c1
Sequence:CCGGGTGTTTCCTTAGGGCAATTATCTCGAGATAATTGCCCTAAGGAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)