EMAIL THIS PAGE TO A FRIEND

HEXIM2

hexamethylene bis-acetamide inducible 2

99 Gene Product Result for
UniProtKB ID: Q96MH2, D3DX66
Gene ID:
Mouse(71059) hexamethylene bis-acetamide inducible 2
Rat(303580) hexamethylene bis-acetamide inducible 2
sheep(101118541) hexamethylene bis-acetamide inducible 2
dog(606799) hexamethylene bis-acetamide inducible 2
domestic cat(101086767) hexamethylene bis-acetamide inducible 2
cow(614679) hexamethylene bis-acetamide inducible 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144608 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001130515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001130515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001130515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144608 Rosetta Predictions human pricing
NM_001107054 Rosetta Predictions rat pricing
NM_001130515 Rosetta Predictions mouse pricing
NM_001130516 Rosetta Predictions mouse pricing
NM_027658 Rosetta Predictions mouse pricing
XM_203501 Rosetta Predictions mouse pricing
XM_903070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209546 predicted 613
2 SASI_Hs01_00209548 predicted 256
3 SASI_Hs01_00209549 predicted 1031
4 SASI_Hs01_00209550 predicted 789
5 SASI_Hs01_00209551 predicted 1032
6 SASI_Hs02_00364413 predicted 716
7 SASI_Hs01_00209552 predicted 538
8 SASI_Hs01_00209553 predicted 384
9 SASI_Hs01_00209554 predicted 794
10 SASI_Hs01_00209555 predicted 344
11 SASI_Hs01_00209547 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225036 predicted 955
2 SASI_Rn02_00225037 predicted 1009
3 SASI_Rn02_00225038 predicted 1166
4 SASI_Rn02_00225039 predicted 559
5 SASI_Rn02_00225040 predicted 940
6 SASI_Rn02_00225041 predicted 509
7 SASI_Rn02_00225042 predicted 1205
8 SASI_Rn02_00225043 predicted 465
9 SASI_Rn02_00225044 predicted 379
10 SASI_Rn02_00225045 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311350 predicted 1119
2 SASI_Mm02_00311351 predicted 1072
3 SASI_Mm02_00311352 predicted 1178
4 SASI_Mm02_00311353 predicted 1536
5 SASI_Mm02_00311354 predicted 1032
6 SASI_Mm02_00311355 predicted 374
7 SASI_Mm02_00311356 predicted 1021
8 SASI_Mm02_00311357 predicted 568
9 SASI_Mm02_00311358 predicted 935
10 SASI_Mm02_00311359 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311360 predicted 1135
2 SASI_Mm02_00311361 predicted 1091
3 SASI_Mm02_00311362 predicted 1194
4 SASI_Mm02_00311363 predicted 1545
5 SASI_Mm02_00311364 predicted 1044
6 SASI_Mm02_00311365 predicted 396
7 SASI_Mm02_00311366 predicted 1047
8 SASI_Mm02_00311367 predicted 592
9 SASI_Mm02_00311368 predicted 958
10 SASI_Mm02_00311369 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332532 predicted 1150
2 SASI_Mm02_00332533 predicted 1096
3 SASI_Mm02_00332534 predicted 1208
4 SASI_Mm02_00332535 predicted 1557
5 SASI_Mm02_00332536 predicted 1053
6 SASI_Mm02_00332537 predicted 402
7 SASI_Mm02_00332538 predicted 1056
8 SASI_Mm02_00332539 predicted 603
9 SASI_Mm02_00332540 predicted 969
10 SASI_Mm02_00332541 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280183 predicted 1510
2 SASI_Mm01_00280184 predicted 1157
3 SASI_Mm01_00280185 predicted 1117
4 SASI_Mm01_00280186 predicted 1223
5 SASI_Mm01_00280187 predicted 1572
6 SASI_Mm01_00280188 predicted 1069
7 SASI_Mm01_00280189 predicted 418
8 SASI_Mm01_00280190 predicted 1072
9 SASI_Mm01_00280191 predicted 610
10 SASI_Mm01_00280192 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253398 predicted 1519
2 SASI_Mm01_00253399 predicted 1169
3 SASI_Mm01_00253400 predicted 1117
4 SASI_Mm01_00253401 predicted 1232
5 SASI_Mm01_00253402 predicted 1582
6 SASI_Mm01_00253403 predicted 1071
7 SASI_Mm01_00253404 predicted 420
8 SASI_Mm01_00253405 predicted 1076
9 SASI_Mm01_00253406 predicted 614
10 SASI_Mm01_00253407 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144608
VALIDATED
HEXIM2 MISSION shRNA Bacterial Glycerol Stock
hexamethylene bis-acetamide inducible 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1036s21c1
Sequence:CCGGTTCGTCAGGAGAACCAGATGTCTCGAGACATCTGGTTCTCCTGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1125s21c1
Sequence:CCGGCAAGGAGAAGGTCCCATTTCGCTCGAGCGAAATGGGACCTTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-822s21c1
Sequence:CCGGGAGACTTACGAACGCTTCCACCTCGAGGTGGAAGCGTTCGTAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1133s21c1
Sequence:CCGGAGGTCCCATTTCGTGCACACTCTCGAGAGTGTGCACGAAATGGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144608.1-813s1c1
Sequence:CCGGGACTTCTCTGAGACTTACGAACTCGAGTTCGTAAGTCTCAGAGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144608.1-809s1c1
Sequence:CCGGGAAGGACTTCTCTGAGACTTACTCGAGTAAGTCTCAGAGAAGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-814s21c1
Sequence:CCGGACTTCTCTGAGACTTACGAACCTCGAGGTTCGTAAGTCTCAGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-667s21c1
Sequence:CCGGCCACCCAGTTCCTGATGAATGCTCGAGCATTCATCAGGAACTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-623s21c1
Sequence:CCGGCGAAGAGATGTTCGCCAAAGGCTCGAGCCTTTGGCGAACATCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-388s21c1
Sequence:CCGGAGAGCCACTCAGAGGATGAAGCTCGAGCTTCATCCTCTGAGTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-572s21c1
Sequence:CCGGTGAGAAACAACAGCGGGATGACTCGAGTCATCCCGCTGTTGTTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144608
VALIDATED
HEXIM2 MISSION shRNA shRNA Plasmid DNA
hexamethylene bis-acetamide inducible 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1036s21c1
Sequence:CCGGTTCGTCAGGAGAACCAGATGTCTCGAGACATCTGGTTCTCCTGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1125s21c1
Sequence:CCGGCAAGGAGAAGGTCCCATTTCGCTCGAGCGAAATGGGACCTTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-822s21c1
Sequence:CCGGGAGACTTACGAACGCTTCCACCTCGAGGTGGAAGCGTTCGTAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1133s21c1
Sequence:CCGGAGGTCCCATTTCGTGCACACTCTCGAGAGTGTGCACGAAATGGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144608.1-813s1c1
Sequence:CCGGGACTTCTCTGAGACTTACGAACTCGAGTTCGTAAGTCTCAGAGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144608.1-809s1c1
Sequence:CCGGGAAGGACTTCTCTGAGACTTACTCGAGTAAGTCTCAGAGAAGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-814s21c1
Sequence:CCGGACTTCTCTGAGACTTACGAACCTCGAGGTTCGTAAGTCTCAGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-667s21c1
Sequence:CCGGCCACCCAGTTCCTGATGAATGCTCGAGCATTCATCAGGAACTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-623s21c1
Sequence:CCGGCGAAGAGATGTTCGCCAAAGGCTCGAGCCTTTGGCGAACATCTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-388s21c1
Sequence:CCGGAGAGCCACTCAGAGGATGAAGCTCGAGCTTCATCCTCTGAGTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-572s21c1
Sequence:CCGGTGAGAAACAACAGCGGGATGACTCGAGTCATCCCGCTGTTGTTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144608
VALIDATED
HEXIM2 MISSION shRNA Lentiviral Transduction Particles
hexamethylene bis-acetamide inducible 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1036s21c1
Sequence:CCGGTTCGTCAGGAGAACCAGATGTCTCGAGACATCTGGTTCTCCTGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1125s21c1
Sequence:CCGGCAAGGAGAAGGTCCCATTTCGCTCGAGCGAAATGGGACCTTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-822s21c1
Sequence:CCGGGAGACTTACGAACGCTTCCACCTCGAGGTGGAAGCGTTCGTAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-1133s21c1
Sequence:CCGGAGGTCCCATTTCGTGCACACTCTCGAGAGTGTGCACGAAATGGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144608.1-813s1c1
Sequence:CCGGGACTTCTCTGAGACTTACGAACTCGAGTTCGTAAGTCTCAGAGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144608.1-809s1c1
Sequence:CCGGGAAGGACTTCTCTGAGACTTACTCGAGTAAGTCTCAGAGAAGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-814s21c1
Sequence:CCGGACTTCTCTGAGACTTACGAACCTCGAGGTTCGTAAGTCTCAGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-667s21c1
Sequence:CCGGCCACCCAGTTCCTGATGAATGCTCGAGCATTCATCAGGAACTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-623s21c1
Sequence:CCGGCGAAGAGATGTTCGCCAAAGGCTCGAGCCTTTGGCGAACATCTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-388s21c1
Sequence:CCGGAGAGCCACTCAGAGGATGAAGCTCGAGCTTCATCCTCTGAGTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144608.1-572s21c1
Sequence:CCGGTGAGAAACAACAGCGGGATGACTCGAGTCATCCCGCTGTTGTTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130515
HEXIM2 MISSION shRNA Bacterial Glycerol Stock
hexamethylene bis-acetamide inducible 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-248s21c1
Sequence:CCGGCATCAGGACAGGAGATCCAATCTCGAGATTGGATCTCCTGTCCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-753s21c1
Sequence:CCGGGCGAGACTACCTGGATCTAGACTCGAGTCTAGATCCAGGTAGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-299s21c1
Sequence:CCGGATGGCTCAAGTTGTAACATTACTCGAGTAATGTTACAACTTGAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-908s21c1
Sequence:CCGGTGCGTCAGGAGAACGAGATGTCTCGAGACATCTCGTTCTCCTGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130515
HEXIM2 MISSION shRNA shRNA Plasmid DNA
hexamethylene bis-acetamide inducible 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-248s21c1
Sequence:CCGGCATCAGGACAGGAGATCCAATCTCGAGATTGGATCTCCTGTCCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-753s21c1
Sequence:CCGGGCGAGACTACCTGGATCTAGACTCGAGTCTAGATCCAGGTAGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-299s21c1
Sequence:CCGGATGGCTCAAGTTGTAACATTACTCGAGTAATGTTACAACTTGAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-908s21c1
Sequence:CCGGTGCGTCAGGAGAACGAGATGTCTCGAGACATCTCGTTCTCCTGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130515
HEXIM2 MISSION shRNA Lentiviral Transduction Particles
hexamethylene bis-acetamide inducible 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-248s21c1
Sequence:CCGGCATCAGGACAGGAGATCCAATCTCGAGATTGGATCTCCTGTCCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-753s21c1
Sequence:CCGGGCGAGACTACCTGGATCTAGACTCGAGTCTAGATCCAGGTAGTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-299s21c1
Sequence:CCGGATGGCTCAAGTTGTAACATTACTCGAGTAATGTTACAACTTGAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130515.1-908s21c1
Sequence:CCGGTGCGTCAGGAGAACGAGATGTCTCGAGACATCTCGTTCTCCTGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)