EMAIL THIS PAGE TO A FRIEND

HEY1

hairy/enhancer-of-split related with YRPW motif 1

149 Gene Product Result for
Synonyms: BHLHb31 CHF2 HERP2 HESR1 HRT-1 OAF1
UniProtKB ID: Q9Y5J3, B2R883, Q5TZS3, Q8NAM2, Q9NYP4
Gene ID:
Human(23462) Summary: This gene encodes a nuclear protein belonging to the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcriptional repressors. Expression of this gene is induced by the Notch and c-Jun signal transduction pathways. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(15213) hairy/enhancer-of-split related with YRPW motif 1
Rat(155437) hairy/enhancer-of-split related with YRPW motif 1
Zebrafish(58008) hairy/enhancer-of-split related with YRPW motif 1
dog(403420) hairy/enhancer-of-split related with YRPW motif 1
domestic cat(101085436) hairy/enhancer-of-split related with YRPW motif 1
cow(408005) hairy/enhancer-of-split related with YRPW motif 1
chicken(428365) hairy/enhancer-of-split related with YRPW motif 1
domestic guinea pig(100734127) hairy/enhancer-of-split related with YRPW motif 1
naked mole-rat(101711615) hairy/enhancer-of-split related with YRPW motif 1
sheep(101111557) hairy/enhancer-of-split related with YRPW motif 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32512 Anti-HEY1 antibody produced in rabbit IgG fraction of antiserum guinea pig, canine, rat, mouse, rabbit, horse
immunohistochemistry, western blot pricing
HPA055599 Anti-HEY1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106265 Anti-HEY1 antibody produced in rabbit affinity isolated antibody rat, guinea pig, horse, human
western blot pricing
HPA063472 Anti-HEY1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2104807 Anti-HEY1, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, horse, canine, rat, human, sheep, guinea pig, rabbit
western blot pricing
GW22161 Anti-SRP54 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
WH0023462M1 Monoclonal Anti-HEY1 antibody produced in mouse clone 3B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404975 Monoclonal Anti-HEY1 antibody produced in mouse clone 2F10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409029 Monoclonal Anti-HEY1 antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409030 Monoclonal Anti-HEY1 antibody produced in mouse clone 4B3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012258 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040708 Rosetta Predictions human pricing
NM_012258 Rosetta Predictions human pricing
XM_001057389 Rosetta Predictions rat pricing
XM_342216 Rosetta Predictions rat pricing
NM_010423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309099 predicted 1026
2 SASI_Hs02_00309100 predicted 1542
3 SASI_Hs02_00309101 predicted 1581
4 SASI_Hs02_00309102 predicted 1591
5 SASI_Hs02_00309103 predicted 610
6 SASI_Hs02_00309104 predicted 1464
7 SASI_Hs02_00309105 predicted 1376
8 SASI_Hs02_00309106 predicted 562
9 SASI_Hs02_00309107 predicted 1073
10 SASI_Hs02_00309108 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052320 predicted 1011
2 SASI_Hs01_00052321 predicted 1532
3 SASI_Hs01_00052324 predicted 1571
4 SASI_Hs02_00343973 predicted 1585
5 SASI_Hs01_00052318 predicted 603
6 SASI_Hs02_00343974 predicted 1454
7 SASI_Hs02_00343975 predicted 1362
8 SASI_Hs01_00052322 predicted 551
9 SASI_Hs02_00343976 predicted 1055
10 SASI_Hs01_00052326 predicted 558
11 SASI_Hs01_00052319 predicted 664
12 SASI_Hs01_00052323 predicted 290
13 SASI_Hs01_00052325 predicted 554
14 SASI_Hs01_00052327 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286192 predicted 508
2 SASI_Rn02_00286193 predicted 242
3 SASI_Rn02_00286194 predicted 561
4 SASI_Rn02_00286195 predicted 569
5 SASI_Rn02_00286196 predicted 345
6 SASI_Rn02_00286197 predicted 560
7 SASI_Rn02_00286198 predicted 343
8 SASI_Rn02_00286199 predicted 235
9 SASI_Rn02_00286200 predicted 543
10 SASI_Rn02_00286201 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393936 predicted 356
2 SASI_Rn02_00393937 predicted 355
3 SASI_Rn02_00393938 predicted 350
4 SASI_Rn02_00393939 predicted 348
5 SASI_Rn02_00393940 predicted 1497
6 SASI_Rn02_00393941 predicted 216
7 SASI_Rn02_00393942 predicted 546
8 SASI_Rn02_00393943 predicted 1433
9 SASI_Rn02_00393944 predicted 1552
10 SASI_Rn02_00393945 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046406 predicted 516
2 SASI_Mm02_00318570 predicted 210
3 SASI_Mm01_00046408 predicted 565
4 SASI_Mm01_00046409 predicted 346
5 SASI_Mm01_00046410 predicted 1566
6 SASI_Mm02_00318571 predicted 1441
7 SASI_Mm02_00318572 predicted 1464
8 SASI_Mm02_00318573 predicted 1518
9 SASI_Mm01_00046413 predicted 384
10 SASI_Mm01_00046414 predicted 345
11 SASI_Mm01_00046407 predicted 1085
12 SASI_Mm01_00046411 predicted 959
13 SASI_Mm01_00046412 predicted 1071
14 SASI_Mm01_00046415 predicted 999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010423
VALIDATED
HEY1 MISSION shRNA Bacterial Glycerol Stock
hairy/enhancer-of-split related with YRPW motif 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010423.1-519s1c1
Sequence:CCGGGCCCGTTATCTGAGCATCATTCTCGAGAATGATGCTCAGATAACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010423.1-302s1c1
Sequence:CCGGAGACCGAATCAATAACAGTTTCTCGAGAAACTGTTATTGATTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010423.1-296s1c1
Sequence:CCGGCCGACGAGACCGAATCAATAACTCGAGTTATTGATTCGGTCTCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010423.1-583s1c1
Sequence:CCGGCCCATCTCAACAACTACGCATCTCGAGATGCGTAGTTGTTGAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-1049s21c1
Sequence:CCGGCAGAGATCGGAGCTTTCTAAACTCGAGTTTAGAAAGCTCCGATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010423.2-1531s21c1
Sequence:CCGGAGGTGTTGTATAAGTGGTATTCTCGAGAATACCACTTATACAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-572s21c1
Sequence:CCGGCCCGTTATCTGAGCATCATTGCTCGAGCAATGATGCTCAGATAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-348s21c1
Sequence:CCGGCCGACGAGACCGAATCAATAACTCGAGTTATTGATTCGGTCTCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-486s21c1
Sequence:CCGGTGCAGGAGGGAAAGGTTATTTCTCGAGAAATAACCTTTCCCTCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010423.2-1481s21c1
Sequence:CCGGCGCCACTATGCTCAATGTTAACTCGAGTTAACATTGAGCATAGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010423
VALIDATED
HEY1 MISSION shRNA shRNA Plasmid DNA
hairy/enhancer-of-split related with YRPW motif 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010423.1-519s1c1
Sequence:CCGGGCCCGTTATCTGAGCATCATTCTCGAGAATGATGCTCAGATAACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010423.1-302s1c1
Sequence:CCGGAGACCGAATCAATAACAGTTTCTCGAGAAACTGTTATTGATTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010423.1-296s1c1
Sequence:CCGGCCGACGAGACCGAATCAATAACTCGAGTTATTGATTCGGTCTCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010423.1-583s1c1
Sequence:CCGGCCCATCTCAACAACTACGCATCTCGAGATGCGTAGTTGTTGAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-1049s21c1
Sequence:CCGGCAGAGATCGGAGCTTTCTAAACTCGAGTTTAGAAAGCTCCGATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010423.2-1531s21c1
Sequence:CCGGAGGTGTTGTATAAGTGGTATTCTCGAGAATACCACTTATACAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-572s21c1
Sequence:CCGGCCCGTTATCTGAGCATCATTGCTCGAGCAATGATGCTCAGATAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-348s21c1
Sequence:CCGGCCGACGAGACCGAATCAATAACTCGAGTTATTGATTCGGTCTCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-486s21c1
Sequence:CCGGTGCAGGAGGGAAAGGTTATTTCTCGAGAAATAACCTTTCCCTCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010423.2-1481s21c1
Sequence:CCGGCGCCACTATGCTCAATGTTAACTCGAGTTAACATTGAGCATAGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010423
VALIDATED
HEY1 MISSION shRNA Lentiviral Transduction Particles
hairy/enhancer-of-split related with YRPW motif 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010423.1-519s1c1
Sequence:CCGGGCCCGTTATCTGAGCATCATTCTCGAGAATGATGCTCAGATAACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010423.1-302s1c1
Sequence:CCGGAGACCGAATCAATAACAGTTTCTCGAGAAACTGTTATTGATTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010423.1-296s1c1
Sequence:CCGGCCGACGAGACCGAATCAATAACTCGAGTTATTGATTCGGTCTCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010423.1-583s1c1
Sequence:CCGGCCCATCTCAACAACTACGCATCTCGAGATGCGTAGTTGTTGAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-1049s21c1
Sequence:CCGGCAGAGATCGGAGCTTTCTAAACTCGAGTTTAGAAAGCTCCGATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010423.2-1531s21c1
Sequence:CCGGAGGTGTTGTATAAGTGGTATTCTCGAGAATACCACTTATACAACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-572s21c1
Sequence:CCGGCCCGTTATCTGAGCATCATTGCTCGAGCAATGATGCTCAGATAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-348s21c1
Sequence:CCGGCCGACGAGACCGAATCAATAACTCGAGTTATTGATTCGGTCTCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010423.2-486s21c1
Sequence:CCGGTGCAGGAGGGAAAGGTTATTTCTCGAGAAATAACCTTTCCCTCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010423.2-1481s21c1
Sequence:CCGGCGCCACTATGCTCAATGTTAACTCGAGTTAACATTGAGCATAGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012258
VALIDATED
HEY1 MISSION shRNA Bacterial Glycerol Stock
hairy/enhancer-of-split related with YRPW motif 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-509s1c1
Sequence:CCGGGCGCGTTATCTGAGCATCATTCTCGAGAATGATGCTCAGATAACGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012258.2-916s1c1
Sequence:CCGGCTTCCACTTACTGTCTCCCAACTCGAGTTGGGAGACAGTAAGTGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-425s1c1
Sequence:CCGGGCAGGAGGGAAAGGTTACTTTCTCGAGAAAGTAACCTTTCCCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-226s1c1
Sequence:CCGGCCCAACTACATCTTCCCAGATCTCGAGATCTGGGAAGATGTAGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012258.3-667s21c1
Sequence:CCGGCGCATCTCAACAACTACGCTTCTCGAGAAGCGTAGTTGTTGAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012258.3-1170s21c1
Sequence:CCGGTGTTGCCAACATCACCTTAAACTCGAGTTTAAGGTGATGTTGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-320s21c1
Sequence:CCGGCCCAACTACATCTTCCCAGATCTCGAGATCTGGGAAGATGTAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-380s21c1
Sequence:CCGGCCGACGAGACCGGATCAATAACTCGAGTTATTGATCCGGTCTCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-519s21c1
Sequence:CCGGGCAGGAGGGAAAGGTTACTTTCTCGAGAAAGTAACCTTTCCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012258
VALIDATED
HEY1 MISSION shRNA shRNA Plasmid DNA
hairy/enhancer-of-split related with YRPW motif 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-509s1c1
Sequence:CCGGGCGCGTTATCTGAGCATCATTCTCGAGAATGATGCTCAGATAACGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012258.2-916s1c1
Sequence:CCGGCTTCCACTTACTGTCTCCCAACTCGAGTTGGGAGACAGTAAGTGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-425s1c1
Sequence:CCGGGCAGGAGGGAAAGGTTACTTTCTCGAGAAAGTAACCTTTCCCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-226s1c1
Sequence:CCGGCCCAACTACATCTTCCCAGATCTCGAGATCTGGGAAGATGTAGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012258.3-667s21c1
Sequence:CCGGCGCATCTCAACAACTACGCTTCTCGAGAAGCGTAGTTGTTGAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012258.3-1170s21c1
Sequence:CCGGTGTTGCCAACATCACCTTAAACTCGAGTTTAAGGTGATGTTGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-320s21c1
Sequence:CCGGCCCAACTACATCTTCCCAGATCTCGAGATCTGGGAAGATGTAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-380s21c1
Sequence:CCGGCCGACGAGACCGGATCAATAACTCGAGTTATTGATCCGGTCTCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-519s21c1
Sequence:CCGGGCAGGAGGGAAAGGTTACTTTCTCGAGAAAGTAACCTTTCCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012258
VALIDATED
HEY1 MISSION shRNA Lentiviral Transduction Particles
hairy/enhancer-of-split related with YRPW motif 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-509s1c1
Sequence:CCGGGCGCGTTATCTGAGCATCATTCTCGAGAATGATGCTCAGATAACGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012258.2-916s1c1
Sequence:CCGGCTTCCACTTACTGTCTCCCAACTCGAGTTGGGAGACAGTAAGTGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-425s1c1
Sequence:CCGGGCAGGAGGGAAAGGTTACTTTCTCGAGAAAGTAACCTTTCCCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_012258.2-226s1c1
Sequence:CCGGCCCAACTACATCTTCCCAGATCTCGAGATCTGGGAAGATGTAGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012258.3-667s21c1
Sequence:CCGGCGCATCTCAACAACTACGCTTCTCGAGAAGCGTAGTTGTTGAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012258.3-1170s21c1
Sequence:CCGGTGTTGCCAACATCACCTTAAACTCGAGTTTAAGGTGATGTTGGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-320s21c1
Sequence:CCGGCCCAACTACATCTTCCCAGATCTCGAGATCTGGGAAGATGTAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-380s21c1
Sequence:CCGGCCGACGAGACCGGATCAATAACTCGAGTTATTGATCCGGTCTCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012258.3-519s21c1
Sequence:CCGGGCAGGAGGGAAAGGTTACTTTCTCGAGAAAGTAACCTTTCCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)