EMAIL THIS PAGE TO A FRIEND

HEYL

hairy/enhancer-of-split related with YRPW motif-like

94 Gene Product Result for
Synonyms: HESR3 HEY3 HRT3 bHLHb33
UniProtKB ID: Q9NQ87, Q5TG99
Gene ID:
Human(26508) Summary: This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The sequence of the encoded protein contains a conserved bHLH and orange domain, but its YRPW motif has diverged from other HESR family members. It is thought to be an effector of Notch signaling and a regulator of cell fate decisions. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(56198) hairy/enhancer-of-split related with YRPW motif-like
Rat(313575) hairy/enhancer-of-split related with YRPW motif-like
Zebrafish(335134) hairy/enhancer-of-split related with YRPW motif-like
cow(538609) hairy/enhancer-of-split related with YRPW motif-like
domestic cat(101089629) hairy/enhancer-of-split related with YRPW motif-like
dog(607804) hairy/enhancer-of-split related with YRPW motif-like
chicken(771101) hairy/enhancer-of-split related with YRPW motif-like
domestic guinea pig(100718167) hairy/enhancer-of-split related with YRPW motif-like
naked mole-rat(101713703) hairy/enhancer-of-split related with YRPW motif-like
sheep(101119343) hairy/enhancer-of-split related with YRPW motif-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22333A Anti-HEYL (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW22333B Anti-HEYL (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1412221 ANTI-HEYL antibody produced in mouse clone 2B4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1412295 ANTI-HEYL antibody produced in mouse clone 3D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412296 ANTI-HEYL antibody produced in mouse clone 1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412297 ANTI-HEYL antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412298 ANTI-HEYL antibody produced in mouse clone 3B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412389 ANTI-HEYL antibody produced in mouse clone 4A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412552 ANTI-HEYL antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412624 ANTI-HEYL antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2107876 Anti-HEYL antibody produced in rabbit IgG fraction of antiserum horse, canine, bovine, rat, mouse, guinea pig, human
western blot pricing
HPA001438 Anti-HEYL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0026508M2 Monoclonal Anti-HEYL antibody produced in mouse clone 4A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405020 Monoclonal Anti-HEYL antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014571 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044601 MISSION® esiRNA esiRNA human HEYL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014571 Rosetta Predictions human pricing
NM_001107977 Rosetta Predictions rat pricing
NM_013905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100671 predicted 385
2 SASI_Hs02_00345837 predicted 217
3 SASI_Hs01_00100672 predicted 1504
4 SASI_Hs01_00100673 predicted 280
5 SASI_Hs01_00100674 predicted 1144
6 SASI_Hs01_00100675 predicted 276
7 SASI_Hs01_00100676 predicted 1061
8 SASI_Hs01_00100677 predicted 1200
9 SASI_Hs01_00100678 predicted 311
10 SASI_Hs01_00100679 predicted 905
11 SASI_Hs01_00100680 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234145 predicted 642
2 SASI_Rn02_00234146 predicted 1407
3 SASI_Rn02_00234147 predicted 1250
4 SASI_Rn02_00234148 predicted 1179
5 SASI_Rn02_00234149 predicted 1584
6 SASI_Rn02_00234150 predicted 1761
7 SASI_Rn02_00234151 predicted 1655
8 SASI_Rn02_00234152 predicted 785
9 SASI_Rn02_00234153 predicted 352
10 SASI_Rn02_00234154 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137911 predicted 676
2 SASI_Mm02_00322988 predicted 473
3 SASI_Mm01_00137914 predicted 641
4 SASI_Mm02_00322989 predicted 357
5 SASI_Mm01_00137916 predicted 681
6 SASI_Mm02_00322990 predicted 440
7 SASI_Mm02_00322991 predicted 391
8 SASI_Mm01_00137917 predicted 651
9 SASI_Mm01_00137918 predicted 1736
10 SASI_Mm02_00322992 predicted 347
11 SASI_Mm01_00137912 predicted 1315
12 SASI_Mm01_00137913 predicted 1426
13 SASI_Mm01_00137915 predicted 357
14 SASI_Mm01_00137919 predicted 721
15 SASI_Mm01_00137920 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013905
HEYL MISSION shRNA Bacterial Glycerol Stock
hairy/enhancer-of-split related with YRPW motif-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013905.2-1921s1c1
Sequence:CCGGGCGGACAAAGTGTGGAAACATCTCGAGATGTTTCCACACTTTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-73s1c1
Sequence:CCGGGTGGGTCAAGAGAACGATCTTCTCGAGAAGATCGTTCTCTTGACCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-961s1c1
Sequence:CCGGTGGGTCTCAGAAATCACTGAACTCGAGTTCAGTGATTTCTGAGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-352s1c1
Sequence:CCGGGCTGTTGACTTCCGGAGTATTCTCGAGAATACTCCGGAAGTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-201s1c1
Sequence:CCGGCCTTTCTGAATTGCGACGATTCTCGAGAATCGTCGCAATTCAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-1176s21c1
Sequence:CCGGGACAATGTGTCTGGTTCTATCCTCGAGGATAGAACCAGACACATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-445s21c1
Sequence:CCGGAGAAGCGCAGAGGGATCATAGCTCGAGCTATGATCCCTCTGCGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-578s21c1
Sequence:CCGGGATGACCGTGGATCACTTGAACTCGAGTTCAAGTGATCCACGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013905
HEYL MISSION shRNA shRNA Plasmid DNA
hairy/enhancer-of-split related with YRPW motif-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013905.2-1921s1c1
Sequence:CCGGGCGGACAAAGTGTGGAAACATCTCGAGATGTTTCCACACTTTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-73s1c1
Sequence:CCGGGTGGGTCAAGAGAACGATCTTCTCGAGAAGATCGTTCTCTTGACCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-961s1c1
Sequence:CCGGTGGGTCTCAGAAATCACTGAACTCGAGTTCAGTGATTTCTGAGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-352s1c1
Sequence:CCGGGCTGTTGACTTCCGGAGTATTCTCGAGAATACTCCGGAAGTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-201s1c1
Sequence:CCGGCCTTTCTGAATTGCGACGATTCTCGAGAATCGTCGCAATTCAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-1176s21c1
Sequence:CCGGGACAATGTGTCTGGTTCTATCCTCGAGGATAGAACCAGACACATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-445s21c1
Sequence:CCGGAGAAGCGCAGAGGGATCATAGCTCGAGCTATGATCCCTCTGCGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-578s21c1
Sequence:CCGGGATGACCGTGGATCACTTGAACTCGAGTTCAAGTGATCCACGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013905
HEYL MISSION shRNA Lentiviral Transduction Particles
hairy/enhancer-of-split related with YRPW motif-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013905.2-1921s1c1
Sequence:CCGGGCGGACAAAGTGTGGAAACATCTCGAGATGTTTCCACACTTTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-73s1c1
Sequence:CCGGGTGGGTCAAGAGAACGATCTTCTCGAGAAGATCGTTCTCTTGACCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-961s1c1
Sequence:CCGGTGGGTCTCAGAAATCACTGAACTCGAGTTCAGTGATTTCTGAGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-352s1c1
Sequence:CCGGGCTGTTGACTTCCGGAGTATTCTCGAGAATACTCCGGAAGTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013905.2-201s1c1
Sequence:CCGGCCTTTCTGAATTGCGACGATTCTCGAGAATCGTCGCAATTCAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-1176s21c1
Sequence:CCGGGACAATGTGTCTGGTTCTATCCTCGAGGATAGAACCAGACACATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-445s21c1
Sequence:CCGGAGAAGCGCAGAGGGATCATAGCTCGAGCTATGATCCCTCTGCGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013905.3-578s21c1
Sequence:CCGGGATGACCGTGGATCACTTGAACTCGAGTTCAAGTGATCCACGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014571
HEYL MISSION shRNA Bacterial Glycerol Stock
hairy/enhancer-of-split related with YRPW motif-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-207s1c1
Sequence:CCGGCCTTTCTGAATTGCGACGCTTCTCGAGAAGCGTCGCAATTCAGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-160s1c1
Sequence:CCGGCGCAGAGGGATCATAGAGAAACTCGAGTTTCTCTATGATCCCTCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-358s1c1
Sequence:CCGGGCAGTTGACTTCCGGAGCATTCTCGAGAATGCTCCGGAAGTCAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-973s1c1
Sequence:CCGGTGGGTCTCTGAAATCACTGAACTCGAGTTCAGTGATTTCAGAGACCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-636s1c1
Sequence:CCGGCGGTGTCTCCTCTCCTGCTTACTCGAGTAAGCAGGAGAGGAGACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014571.3-319s21c1
Sequence:CCGGATGACGGTGGATCACTTGAAACTCGAGTTTCAAGTGATCCACCGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014571
HEYL MISSION shRNA shRNA Plasmid DNA
hairy/enhancer-of-split related with YRPW motif-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-207s1c1
Sequence:CCGGCCTTTCTGAATTGCGACGCTTCTCGAGAAGCGTCGCAATTCAGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-160s1c1
Sequence:CCGGCGCAGAGGGATCATAGAGAAACTCGAGTTTCTCTATGATCCCTCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-358s1c1
Sequence:CCGGGCAGTTGACTTCCGGAGCATTCTCGAGAATGCTCCGGAAGTCAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-973s1c1
Sequence:CCGGTGGGTCTCTGAAATCACTGAACTCGAGTTCAGTGATTTCAGAGACCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-636s1c1
Sequence:CCGGCGGTGTCTCCTCTCCTGCTTACTCGAGTAAGCAGGAGAGGAGACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014571.3-319s21c1
Sequence:CCGGATGACGGTGGATCACTTGAAACTCGAGTTTCAAGTGATCCACCGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014571
HEYL MISSION shRNA Lentiviral Transduction Particles
hairy/enhancer-of-split related with YRPW motif-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-207s1c1
Sequence:CCGGCCTTTCTGAATTGCGACGCTTCTCGAGAAGCGTCGCAATTCAGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-160s1c1
Sequence:CCGGCGCAGAGGGATCATAGAGAAACTCGAGTTTCTCTATGATCCCTCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-358s1c1
Sequence:CCGGGCAGTTGACTTCCGGAGCATTCTCGAGAATGCTCCGGAAGTCAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-973s1c1
Sequence:CCGGTGGGTCTCTGAAATCACTGAACTCGAGTTCAGTGATTTCAGAGACCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014571.2-636s1c1
Sequence:CCGGCGGTGTCTCCTCTCCTGCTTACTCGAGTAAGCAGGAGAGGAGACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014571.3-319s21c1
Sequence:CCGGATGACGGTGGATCACTTGAAACTCGAGTTTCAAGTGATCCACCGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)