EMAIL THIS PAGE TO A FRIEND

HFE2

hemochromatosis type 2 (juvenile)

124 Gene Product Result for
Synonyms: HFE2A HJV JH RGMC
UniProtKB ID: Q6ZVN8, B1ALI7, Q2PQ63, Q6IMF6, Q8NAH2, Q8WVJ5
Gene ID:
Human(148738) Summary: The product of this gene is involved in iron metabolism. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. It could also represent the cellular receptor for hepcidin. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Defects in this gene are the cause of hemochromatosis type 2A, also called juvenile hemochromatosis (JH). JH is an early-onset autosomal recessive disorder due to severe iron overload resulting in hypogonadotrophic hypogonadism, hepatic fibrosis or cirrhosis and cardiomyopathy, occurring typically before age of 30. [provided by RefSeq, Jul 2008]
Mouse(69585) hemochromatosis type 2 (juvenile) (human homolog)
Rat(310681) hemochromatosis type 2 (juvenile)
domestic guinea pig(100733082) hemochromatosis type 2 (juvenile)
naked mole-rat(101705796) hemochromatosis type 2 (juvenile)
sheep(101114997) hemochromatosis type 2 (juvenile)
Zebrafish(321932) hemochromatosis type 2
cow(100335368) hemochromatosis type 2 (juvenile)
domestic cat(101099991) hemochromatosis type 2 (juvenile)
dog(475830) hemochromatosis type 2 (juvenile)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1668 Human RGM-C ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_202004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_202004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_202004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145277 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145277 Rosetta Predictions human pricing
NM_202004 Rosetta Predictions human pricing
NM_213652 Rosetta Predictions human pricing
NM_213653 Rosetta Predictions human pricing
NM_001012080 Rosetta Predictions rat pricing
XM_574999 Rosetta Predictions rat pricing
NM_027126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079784 predicted 1683
2 SASI_Hs01_00079785 predicted 1691
3 SASI_Hs01_00079787 predicted 1454
4 SASI_Hs02_00365153 predicted 1426
5 SASI_Hs01_00079788 predicted 1684
6 SASI_Hs01_00079789 predicted 1673
7 SASI_Hs01_00079790 predicted 1649
8 SASI_Hs01_00079791 predicted 1445
9 SASI_Hs01_00079792 predicted 1678
10 SASI_Hs01_00079793 predicted 1523
11 SASI_Hs01_00079786 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126845 predicted 1166
2 SASI_Hs01_00126846 predicted 1170
3 SASI_Hs01_00126848 predicted 936
4 SASI_Hs02_00373181 predicted 908
5 SASI_Hs01_00126849 predicted 1161
6 SASI_Hs01_00126850 predicted 1146
7 SASI_Hs01_00126851 predicted 1120
8 SASI_Hs01_00126852 predicted 916
9 SASI_Hs01_00126853 predicted 1152
10 SASI_Hs01_00126854 predicted 1001
11 SASI_Hs01_00126847 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146842 predicted 1129
2 SASI_Hs01_00146843 predicted 1131
3 SASI_Hs01_00146845 predicted 897
4 SASI_Hs02_00374340 predicted 865
5 SASI_Hs01_00146846 predicted 1131
6 SASI_Hs01_00146847 predicted 1114
7 SASI_Hs01_00146848 predicted 1082
8 SASI_Hs01_00146849 predicted 885
9 SASI_Hs01_00146850 predicted 1112
10 SASI_Hs01_00146851 predicted 961
11 SASI_Hs01_00146844 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175930 predicted 1868
2 SASI_Hs01_00175931 predicted 1878
3 SASI_Hs01_00175933 predicted 1644
4 SASI_Hs02_00374341 predicted 1612
5 SASI_Hs01_00175934 predicted 1871
6 SASI_Hs01_00175935 predicted 1861
7 SASI_Hs01_00175936 predicted 1828
8 SASI_Hs01_00175937 predicted 1628
9 SASI_Hs01_00175938 predicted 1866
10 SASI_Hs01_00175939 predicted 1707
11 SASI_Hs01_00175932 predicted 1665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200202 predicted 853
2 SASI_Rn02_00200203 predicted 1039
3 SASI_Rn02_00200204 predicted 1579
4 SASI_Rn02_00200205 predicted 931
5 SASI_Rn02_00200206 predicted 698
6 SASI_Rn02_00200207 predicted 891
7 SASI_Rn02_00200208 predicted 1030
8 SASI_Rn02_00200209 predicted 1054
9 SASI_Rn02_00200210 predicted 646
10 SASI_Rn02_00200211 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178687 predicted 745
2 SASI_Rn01_00178688 predicted 938
3 SASI_Rn01_00178689 predicted 1476
4 SASI_Rn01_00178690 predicted 887
5 SASI_Rn01_00178691 predicted 817
6 SASI_Rn01_00178692 predicted 590
7 SASI_Rn01_00178693 predicted 790
8 SASI_Rn01_00178694 predicted 917
9 SASI_Rn01_00178695 predicted 943
10 SASI_Rn01_00178696 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331596 predicted 862
2 SASI_Mm01_00196665 predicted 1051
3 SASI_Mm01_00196667 predicted 1722
4 SASI_Mm01_00196666 predicted 1376
5 SASI_Mm01_00196669 predicted 1723
6 SASI_Mm01_00196670 predicted 1789
7 SASI_Mm02_00331597 predicted 893
8 SASI_Mm01_00196672 predicted 1376
9 SASI_Mm01_00196673 predicted 1031
10 SASI_Mm02_00331598 predicted 1773
11 SASI_Mm01_00196668 predicted 1579
12 SASI_Mm01_00196671 predicted 971
13 SASI_Mm01_00196674 predicted 1386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_202004
HFE2 MISSION shRNA Bacterial Glycerol Stock
hemochromatosis type 2 (juvenile)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000122735    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_202004.2-901s1c1
Sequence:CCGGCCTAGGAGACACGTGAAACAACTCGAGTTGTTTCACGTGTCTCCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_202004.3-1309s21c1
Sequence:CCGGATTAGGGAAAGAAGTCTATTTCTCGAGAAATAGACTTCTTTCCCTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_202004.3-322s21c1
Sequence:CCGGTATCAGGCTGAGGTGGATAATCTCGAGATTATCCACCTCAGCCTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_202004.3-1266s21c1
Sequence:CCGGGACATGATCATTAGCCATAAGCTCGAGCTTATGGCTAATGATCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_202004
HFE2 MISSION shRNA shRNA Plasmid DNA
hemochromatosis type 2 (juvenile)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000122735    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_202004.2-901s1c1
Sequence:CCGGCCTAGGAGACACGTGAAACAACTCGAGTTGTTTCACGTGTCTCCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_202004.3-1309s21c1
Sequence:CCGGATTAGGGAAAGAAGTCTATTTCTCGAGAAATAGACTTCTTTCCCTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_202004.3-322s21c1
Sequence:CCGGTATCAGGCTGAGGTGGATAATCTCGAGATTATCCACCTCAGCCTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_202004.3-1266s21c1
Sequence:CCGGGACATGATCATTAGCCATAAGCTCGAGCTTATGGCTAATGATCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_202004
HFE2 MISSION shRNA Lentiviral Transduction Particles
hemochromatosis type 2 (juvenile)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000122735    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_202004.2-901s1c1
Sequence:CCGGCCTAGGAGACACGTGAAACAACTCGAGTTGTTTCACGTGTCTCCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_202004.3-1309s21c1
Sequence:CCGGATTAGGGAAAGAAGTCTATTTCTCGAGAAATAGACTTCTTTCCCTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_202004.3-322s21c1
Sequence:CCGGTATCAGGCTGAGGTGGATAATCTCGAGATTATCCACCTCAGCCTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_202004.3-1266s21c1
Sequence:CCGGGACATGATCATTAGCCATAAGCTCGAGCTTATGGCTAATGATCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145277
HFE2 MISSION shRNA Bacterial Glycerol Stock
hemochromatosis type 2 (juvenile)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-494s1c1
Sequence:CCGGTGTGACTATGAAGGCCGGTTTCTCGAGAAACCGGCCTTCATAGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-706s1c1
Sequence:CCGGGAAGCTCACCATCATATTTAACTCGAGTTAAATATGATGGTGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-703s1c1
Sequence:CCGGCCGGAAGCTCACCATCATATTCTCGAGAATATGATGGTGAGCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-887s1c1
Sequence:CCGGGCCTACATTGGCACAACTATACTCGAGTATAGTTGTGCCAATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145277.3-1614s1c1
Sequence:CCGGCCTTATAAGTTTAGAGGTCATCTCGAGATGACCTCTAAACTTATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145277
HFE2 MISSION shRNA shRNA Plasmid DNA
hemochromatosis type 2 (juvenile)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-494s1c1
Sequence:CCGGTGTGACTATGAAGGCCGGTTTCTCGAGAAACCGGCCTTCATAGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-706s1c1
Sequence:CCGGGAAGCTCACCATCATATTTAACTCGAGTTAAATATGATGGTGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-703s1c1
Sequence:CCGGCCGGAAGCTCACCATCATATTCTCGAGAATATGATGGTGAGCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-887s1c1
Sequence:CCGGGCCTACATTGGCACAACTATACTCGAGTATAGTTGTGCCAATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145277.3-1614s1c1
Sequence:CCGGCCTTATAAGTTTAGAGGTCATCTCGAGATGACCTCTAAACTTATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145277
HFE2 MISSION shRNA Lentiviral Transduction Particles
hemochromatosis type 2 (juvenile)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-494s1c1
Sequence:CCGGTGTGACTATGAAGGCCGGTTTCTCGAGAAACCGGCCTTCATAGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-706s1c1
Sequence:CCGGGAAGCTCACCATCATATTTAACTCGAGTTAAATATGATGGTGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-703s1c1
Sequence:CCGGCCGGAAGCTCACCATCATATTCTCGAGAATATGATGGTGAGCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145277.3-887s1c1
Sequence:CCGGGCCTACATTGGCACAACTATACTCGAGTATAGTTGTGCCAATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145277.3-1614s1c1
Sequence:CCGGCCTTATAAGTTTAGAGGTCATCTCGAGATGACCTCTAAACTTATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027126
HFE2 MISSION shRNA Bacterial Glycerol Stock
hemochromatosis type 2 (juvenile)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027126.2-1765s1c1
Sequence:CCGGCCACTCTCCATACACCTGATACTCGAGTATCAGGTGTATGGAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1388s1c1
Sequence:CCGGCGAGTCTTCTTGACGGATTTACTCGAGTAAATCCGTCAAGAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1014s1c1
Sequence:CCGGGCTCGAGTTTGTCCATTCAAACTCGAGTTTGAATGGACAAACTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1498s1c1
Sequence:CCGGGTGGCTTTGCTTCAGTAAGTACTCGAGTACTTACTGAAGCAAAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1075s1c1
Sequence:CCGGCATTGGAACAACTATCATCATCTCGAGATGATGATAGTTGTTCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027126.4-778s21c1
Sequence:CCGGAGCTTGGCCCTTGCTAGATAACTCGAGTTATCTAGCAAGGGCCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027126.4-1363s21c1
Sequence:CCGGCCGAATCTTCTTGACGGATTTCTCGAGAAATCCGTCAAGAAGATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027126.4-1779s21c1
Sequence:CCGGGAGATTGTGAGAGTGCTAATGCTCGAGCATTAGCACTCTCACAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027126.4-1509s21c1
Sequence:CCGGGACTGGTTTGGAAACGATTTGCTCGAGCAAATCGTTTCCAAACCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027126
HFE2 MISSION shRNA shRNA Plasmid DNA
hemochromatosis type 2 (juvenile)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027126.2-1765s1c1
Sequence:CCGGCCACTCTCCATACACCTGATACTCGAGTATCAGGTGTATGGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1388s1c1
Sequence:CCGGCGAGTCTTCTTGACGGATTTACTCGAGTAAATCCGTCAAGAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1014s1c1
Sequence:CCGGGCTCGAGTTTGTCCATTCAAACTCGAGTTTGAATGGACAAACTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1498s1c1
Sequence:CCGGGTGGCTTTGCTTCAGTAAGTACTCGAGTACTTACTGAAGCAAAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1075s1c1
Sequence:CCGGCATTGGAACAACTATCATCATCTCGAGATGATGATAGTTGTTCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027126.4-778s21c1
Sequence:CCGGAGCTTGGCCCTTGCTAGATAACTCGAGTTATCTAGCAAGGGCCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027126.4-1363s21c1
Sequence:CCGGCCGAATCTTCTTGACGGATTTCTCGAGAAATCCGTCAAGAAGATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027126.4-1779s21c1
Sequence:CCGGGAGATTGTGAGAGTGCTAATGCTCGAGCATTAGCACTCTCACAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027126.4-1509s21c1
Sequence:CCGGGACTGGTTTGGAAACGATTTGCTCGAGCAAATCGTTTCCAAACCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027126
HFE2 MISSION shRNA Lentiviral Transduction Particles
hemochromatosis type 2 (juvenile)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027126.2-1765s1c1
Sequence:CCGGCCACTCTCCATACACCTGATACTCGAGTATCAGGTGTATGGAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1388s1c1
Sequence:CCGGCGAGTCTTCTTGACGGATTTACTCGAGTAAATCCGTCAAGAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1014s1c1
Sequence:CCGGGCTCGAGTTTGTCCATTCAAACTCGAGTTTGAATGGACAAACTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1498s1c1
Sequence:CCGGGTGGCTTTGCTTCAGTAAGTACTCGAGTACTTACTGAAGCAAAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027126.2-1075s1c1
Sequence:CCGGCATTGGAACAACTATCATCATCTCGAGATGATGATAGTTGTTCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027126.4-778s21c1
Sequence:CCGGAGCTTGGCCCTTGCTAGATAACTCGAGTTATCTAGCAAGGGCCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027126.4-1363s21c1
Sequence:CCGGCCGAATCTTCTTGACGGATTTCTCGAGAAATCCGTCAAGAAGATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027126.4-1779s21c1
Sequence:CCGGGAGATTGTGAGAGTGCTAATGCTCGAGCATTAGCACTCTCACAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027126.4-1509s21c1
Sequence:CCGGGACTGGTTTGGAAACGATTTGCTCGAGCAAATCGTTTCCAAACCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)