EMAIL THIS PAGE TO A FRIEND

HFE

hemochromatosis

166 Gene Product Result for
Synonyms: HFE1 HH HLA-H MVCD7 TFQTL2
Gene ID:
Human(3077) Summary: The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(15216) hemochromatosis
Rat(29199) hemochromatosis
cow(497622) hemochromatosis
domestic cat(101084960) hemochromatosis
dog(100688951) hemochromatosis
sheep(101105539) hemochromatosis
naked mole-rat(101705145) hemochromatosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000410 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000410 Rosetta Predictions human pricing
NM_139002 Rosetta Predictions human pricing
NM_139003 Rosetta Predictions human pricing
NM_139004 Rosetta Predictions human pricing
NM_139005 Rosetta Predictions human pricing
NM_139006 Rosetta Predictions human pricing
NM_139007 Rosetta Predictions human pricing
NM_139008 Rosetta Predictions human pricing
NM_139009 Rosetta Predictions human pricing
NM_139010 Rosetta Predictions human pricing
NM_139011 Rosetta Predictions human pricing
NM_053301 Rosetta Predictions rat pricing
NM_010424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158454 predicted 1304
2 SASI_Hs02_00302503 predicted 1266
3 SASI_Hs01_00158455 predicted 1497
4 SASI_Hs01_00158456 predicted 1452
5 SASI_Hs01_00158457 predicted 1288
6 SASI_Hs01_00158458 predicted 1370
7 SASI_Hs01_00158460 predicted 1486
8 SASI_Hs01_00158461 predicted 1288
9 SASI_Hs01_00158462 predicted 1500
10 SASI_Hs01_00158463 predicted 1385
11 SASI_Hs01_00158459 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061995 predicted 223
2 SASI_Hs01_00061996 predicted 275
3 SASI_Hs01_00061997 predicted 235
4 SASI_Hs01_00061998 predicted 279
5 SASI_Hs01_00061999 predicted 224
6 SASI_Hs01_00062000 predicted 268
7 SASI_Hs01_00062001 predicted 286
8 SASI_Hs01_00062002 predicted 246
9 SASI_Hs01_00062003 predicted 231
10 SASI_Hs01_00062004 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083980 predicted 992
2 SASI_Hs02_00364044 predicted 944
3 SASI_Hs01_00083981 predicted 1179
4 SASI_Hs01_00083982 predicted 1139
5 SASI_Hs01_00083983 predicted 973
6 SASI_Hs01_00083984 predicted 1057
7 SASI_Hs01_00083986 predicted 1175
8 SASI_Hs01_00083987 predicted 968
9 SASI_Hs01_00083988 predicted 1183
10 SASI_Hs01_00083989 predicted 1063
11 SASI_Hs01_00083985 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018434 predicted 1031
2 SASI_Hs02_00364045 predicted 986
3 SASI_Hs01_00018435 predicted 1213
4 SASI_Hs01_00018436 predicted 1181
5 SASI_Hs01_00018437 predicted 1015
6 SASI_Hs01_00018438 predicted 1092
7 SASI_Hs01_00018440 predicted 1212
8 SASI_Hs01_00018441 predicted 1015
9 SASI_Hs01_00018442 predicted 1218
10 SASI_Hs01_00018443 predicted 1109
11 SASI_Hs01_00018439 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126224 predicted 282
2 SASI_Hs01_00126225 predicted 238
3 SASI_Hs01_00126226 predicted 367
4 SASI_Hs01_00126227 predicted 279
5 SASI_Hs01_00126228 predicted 230
6 SASI_Hs01_00126229 predicted 270
7 SASI_Hs01_00126230 predicted 328
8 SASI_Hs01_00126231 predicted 229
9 SASI_Hs01_00126232 predicted 327
10 SASI_Hs01_00126233 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120112 predicted 1264
2 SASI_Hs02_00364046 predicted 1223
3 SASI_Hs01_00120113 predicted 1447
4 SASI_Hs01_00120114 predicted 1410
5 SASI_Hs01_00120115 predicted 1250
6 SASI_Hs01_00120116 predicted 1327
7 SASI_Hs01_00120118 predicted 1444
8 SASI_Hs01_00120119 predicted 1252
9 SASI_Hs01_00120120 predicted 1452
10 SASI_Hs01_00120121 predicted 1341
11 SASI_Hs01_00120117 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046008 predicted 1045
2 SASI_Hs02_00364047 predicted 998
3 SASI_Hs01_00046009 predicted 1231
4 SASI_Hs01_00046010 predicted 1192
5 SASI_Hs01_00046011 predicted 1032
6 SASI_Hs01_00046012 predicted 1107
7 SASI_Hs01_00046014 predicted 1220
8 SASI_Hs01_00046015 predicted 1023
9 SASI_Hs01_00046016 predicted 1229
10 SASI_Hs01_00046017 predicted 1119
11 SASI_Hs01_00046013 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169193 predicted 1002
2 SASI_Hs02_00364048 predicted 955
3 SASI_Hs01_00169194 predicted 1191
4 SASI_Hs01_00169195 predicted 1147
5 SASI_Hs01_00169196 predicted 983
6 SASI_Hs01_00169197 predicted 1069
7 SASI_Hs01_00169199 predicted 1178
8 SASI_Hs01_00169200 predicted 980
9 SASI_Hs01_00169201 predicted 1192
10 SASI_Hs01_00169202 predicted 1075
11 SASI_Hs01_00169198 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226919 predicted 1235
2 SASI_Hs02_00364049 predicted 1190
3 SASI_Hs01_00226920 predicted 1419
4 SASI_Hs01_00226921 predicted 1384
5 SASI_Hs01_00226922 predicted 1224
6 SASI_Hs01_00226923 predicted 1299
7 SASI_Hs01_00226925 predicted 1421
8 SASI_Hs01_00226926 predicted 1222
9 SASI_Hs01_00226927 predicted 1429
10 SASI_Hs01_00226928 predicted 1316
11 SASI_Hs01_00226924 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127005 predicted 764
2 SASI_Hs02_00364050 predicted 723
3 SASI_Hs01_00127006 predicted 954
4 SASI_Hs01_00127007 predicted 917
5 SASI_Hs01_00127008 predicted 753
6 SASI_Hs01_00127009 predicted 836
7 SASI_Hs01_00127011 predicted 946
8 SASI_Hs01_00127012 predicted 745
9 SASI_Hs01_00127013 predicted 956
10 SASI_Hs01_00127014 predicted 844
11 SASI_Hs01_00127010 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111412 predicted 485
2 SASI_Hs02_00364051 predicted 449
3 SASI_Hs01_00111413 predicted 676
4 SASI_Hs01_00111414 predicted 641
5 SASI_Hs01_00111415 predicted 478
6 SASI_Hs01_00111416 predicted 556
7 SASI_Hs01_00111417 predicted 671
8 SASI_Hs01_00111419 predicted 477
9 SASI_Hs01_00111420 predicted 680
10 SASI_Hs01_00111421 predicted 570
11 SASI_Hs01_00111418 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265684 predicted 779
2 SASI_Rn02_00265685 predicted 1260
3 SASI_Rn02_00265686 predicted 734
4 SASI_Rn02_00265687 predicted 356
5 SASI_Rn02_00265688 predicted 1050
6 SASI_Rn02_00265689 predicted 1083
7 SASI_Rn02_00265690 predicted 369
8 SASI_Rn02_00265691 predicted 1130
9 SASI_Rn02_00265692 predicted 456
10 SASI_Rn02_00265693 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186295 predicted 790
2 SASI_Mm01_00186296 predicted 1284
3 SASI_Mm01_00186297 predicted 430
4 SASI_Mm01_00186298 predicted 1088
5 SASI_Mm01_00186301 predicted 966
6 SASI_Mm01_00186302 predicted 1101
7 SASI_Mm01_00186303 predicted 1246
8 SASI_Mm02_00318574 predicted 1429
9 SASI_Mm02_00318575 predicted 1076
10 SASI_Mm02_00318576 predicted 1076
11 SASI_Mm01_00186299 predicted 418
12 SASI_Mm01_00186300 predicted 1294
13 SASI_Mm01_00186304 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000410
VALIDATED
HFE MISSION shRNA Bacterial Glycerol Stock
hemochromatosis
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-1172s1c1
Sequence:CCGGCGTCATCTTGTTCATTGGAATCTCGAGATTCCAATGAACAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000410.2-938s1c1
Sequence:CCGGGCTGAAGGATAAGCAGCCAATCTCGAGATTGGCTGCTTATCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000410.2-449s1c1
Sequence:CCGGCAGTAGAATTTCAAGCCAGATCTCGAGATCTGGCTTGAAATTCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-457s21c1
Sequence:CCGGTGTTGACTTCTGGACTATTATCTCGAGATAATAGTCCAGAAGTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-963s1c1
Sequence:CCGGGCCAAGGAGTTCGAACCTAAACTCGAGTTTAGGTTCGAACTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-345s1c1
Sequence:CCGGCTTGGTCTTTCCTTGTTTGAACTCGAGTTCAAACAAGGAAAGACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000410.3-1290s21c1
Sequence:CCGGCAGGAGAGAGTTGAACCTAAACTCGAGTTTAGGTTCAACTCTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-284s21c1
Sequence:CCGGCTTGGTCTTTCCTTGTTTGAACTCGAGTTCAAACAAGGAAAGACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000410.3-1615s21c1
Sequence:CCGGAGTCATAACCTTACCAGATTTCTCGAGAAATCTGGTAAGGTTATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-902s21c1
Sequence:CCGGGCCAAGGAGTTCGAACCTAAACTCGAGTTTAGGTTCGAACTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-1111s21c1
Sequence:CCGGCGTCATCTTGTTCATTGGAATCTCGAGATTCCAATGAACAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000410
VALIDATED
HFE MISSION shRNA shRNA Plasmid DNA
hemochromatosis
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-1172s1c1
Sequence:CCGGCGTCATCTTGTTCATTGGAATCTCGAGATTCCAATGAACAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000410.2-938s1c1
Sequence:CCGGGCTGAAGGATAAGCAGCCAATCTCGAGATTGGCTGCTTATCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000410.2-449s1c1
Sequence:CCGGCAGTAGAATTTCAAGCCAGATCTCGAGATCTGGCTTGAAATTCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-457s21c1
Sequence:CCGGTGTTGACTTCTGGACTATTATCTCGAGATAATAGTCCAGAAGTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-963s1c1
Sequence:CCGGGCCAAGGAGTTCGAACCTAAACTCGAGTTTAGGTTCGAACTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-345s1c1
Sequence:CCGGCTTGGTCTTTCCTTGTTTGAACTCGAGTTCAAACAAGGAAAGACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000410.3-1290s21c1
Sequence:CCGGCAGGAGAGAGTTGAACCTAAACTCGAGTTTAGGTTCAACTCTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-284s21c1
Sequence:CCGGCTTGGTCTTTCCTTGTTTGAACTCGAGTTCAAACAAGGAAAGACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000410.3-1615s21c1
Sequence:CCGGAGTCATAACCTTACCAGATTTCTCGAGAAATCTGGTAAGGTTATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-902s21c1
Sequence:CCGGGCCAAGGAGTTCGAACCTAAACTCGAGTTTAGGTTCGAACTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-1111s21c1
Sequence:CCGGCGTCATCTTGTTCATTGGAATCTCGAGATTCCAATGAACAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000410
VALIDATED
HFE MISSION shRNA Lentiviral Transduction Particles
hemochromatosis
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-1172s1c1
Sequence:CCGGCGTCATCTTGTTCATTGGAATCTCGAGATTCCAATGAACAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000410.2-938s1c1
Sequence:CCGGGCTGAAGGATAAGCAGCCAATCTCGAGATTGGCTGCTTATCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000410.2-449s1c1
Sequence:CCGGCAGTAGAATTTCAAGCCAGATCTCGAGATCTGGCTTGAAATTCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-457s21c1
Sequence:CCGGTGTTGACTTCTGGACTATTATCTCGAGATAATAGTCCAGAAGTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-963s1c1
Sequence:CCGGGCCAAGGAGTTCGAACCTAAACTCGAGTTTAGGTTCGAACTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000410.2-345s1c1
Sequence:CCGGCTTGGTCTTTCCTTGTTTGAACTCGAGTTCAAACAAGGAAAGACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000410.3-1290s21c1
Sequence:CCGGCAGGAGAGAGTTGAACCTAAACTCGAGTTTAGGTTCAACTCTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-284s21c1
Sequence:CCGGCTTGGTCTTTCCTTGTTTGAACTCGAGTTCAAACAAGGAAAGACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000410.3-1615s21c1
Sequence:CCGGAGTCATAACCTTACCAGATTTCTCGAGAAATCTGGTAAGGTTATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-902s21c1
Sequence:CCGGGCCAAGGAGTTCGAACCTAAACTCGAGTTTAGGTTCGAACTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000410.3-1111s21c1
Sequence:CCGGCGTCATCTTGTTCATTGGAATCTCGAGATTCCAATGAACAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010424
VALIDATED
HFE MISSION shRNA Bacterial Glycerol Stock
hemochromatosis
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-1303s1c1
Sequence:CCGGGCTTTCTCTGTTCACTTTCTTCTCGAGAAGAAAGTGAACAGAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-533s1c1
Sequence:CCGGCGGCTTCTGGAGATATGGTTACTCGAGTAACCATATCTCCAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-833s1c1
Sequence:CCGGGAACATCACTATGAGGTGGTTCTCGAGAACCACCTCATAGTGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-276s1c1
Sequence:CCGGCAGCTCTTTGTGTCCTACAATCTCGAGATTGTAGGACACAAAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-1104s1c1
Sequence:CCGGCTGTTCCTAATCTTAAGGAAACTCGAGTTTCCTTAAGATTAGGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010424
VALIDATED
HFE MISSION shRNA shRNA Plasmid DNA
hemochromatosis
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-1303s1c1
Sequence:CCGGGCTTTCTCTGTTCACTTTCTTCTCGAGAAGAAAGTGAACAGAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-533s1c1
Sequence:CCGGCGGCTTCTGGAGATATGGTTACTCGAGTAACCATATCTCCAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-833s1c1
Sequence:CCGGGAACATCACTATGAGGTGGTTCTCGAGAACCACCTCATAGTGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-276s1c1
Sequence:CCGGCAGCTCTTTGTGTCCTACAATCTCGAGATTGTAGGACACAAAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-1104s1c1
Sequence:CCGGCTGTTCCTAATCTTAAGGAAACTCGAGTTTCCTTAAGATTAGGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010424
VALIDATED
HFE MISSION shRNA Lentiviral Transduction Particles
hemochromatosis
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-1303s1c1
Sequence:CCGGGCTTTCTCTGTTCACTTTCTTCTCGAGAAGAAAGTGAACAGAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-533s1c1
Sequence:CCGGCGGCTTCTGGAGATATGGTTACTCGAGTAACCATATCTCCAGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-833s1c1
Sequence:CCGGGAACATCACTATGAGGTGGTTCTCGAGAACCACCTCATAGTGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-276s1c1
Sequence:CCGGCAGCTCTTTGTGTCCTACAATCTCGAGATTGTAGGACACAAAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010424.2-1104s1c1
Sequence:CCGGCTGTTCCTAATCTTAAGGAAACTCGAGTTTCCTTAAGATTAGGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)